Incidental Mutation 'R0679:Olfr196'
ID61732
Institutional Source Beutler Lab
Gene Symbol Olfr196
Ensembl Gene ENSMUSG00000096695
Gene Nameolfactory receptor 196
SynonymsMOR183-1, GA_x54KRFPKG5P-55389051-55388122
MMRRC Submission 038864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0679 (G1)
Quality Score134
Status Not validated
Chromosome16
Chromosomal Location59166647-59170454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59167616 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 176 (H176Y)
Ref Sequence ENSEMBL: ENSMUSP00000145684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077027] [ENSMUST00000205471] [ENSMUST00000207673]
Predicted Effect probably damaging
Transcript: ENSMUST00000077027
AA Change: H176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076285
Gene: ENSMUSG00000096695
AA Change: H176Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7tm_1 41 290 1.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205471
AA Change: H176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207673
AA Change: H176Y
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,223,122 V1943L probably benign Het
Adgrl3 G A 5: 81,794,977 D1507N probably damaging Het
Cry2 A G 2: 92,413,715 I371T probably damaging Het
L3mbtl3 T A 10: 26,313,933 K478* probably null Het
Plcg1 C T 2: 160,756,910 P842S probably damaging Het
Ros1 T C 10: 52,066,295 R2111G possibly damaging Het
Sox10 A G 15: 79,156,588 S90P probably benign Het
Tbc1d32 A C 10: 56,180,576 Y423D probably damaging Het
Utp15 A T 13: 98,259,403 Y52N probably benign Het
Vps13b T G 15: 35,709,703 I1932S possibly damaging Het
Zfp457 A T 13: 67,293,591 C211S probably damaging Het
Other mutations in Olfr196
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Olfr196 APN 16 59167528 nonsense probably null
PIT4495001:Olfr196 UTSW 16 59167974 missense possibly damaging 0.48
R0312:Olfr196 UTSW 16 59167839 missense probably benign 0.00
R0345:Olfr196 UTSW 16 59167906 missense possibly damaging 0.90
R0644:Olfr196 UTSW 16 59167616 missense probably damaging 1.00
R1709:Olfr196 UTSW 16 59167901 missense probably benign 0.03
R1818:Olfr196 UTSW 16 59167880 missense probably benign 0.00
R2090:Olfr196 UTSW 16 59168140 start codon destroyed probably null 0.99
R5327:Olfr196 UTSW 16 59167620 missense possibly damaging 0.96
R5945:Olfr196 UTSW 16 59168119 missense probably benign 0.42
R6093:Olfr196 UTSW 16 59167967 missense probably damaging 1.00
R6268:Olfr196 UTSW 16 59167293 synonymous probably null
R6487:Olfr196 UTSW 16 59168173 splice site probably null
R6628:Olfr196 UTSW 16 59167981 missense probably benign 0.00
R6679:Olfr196 UTSW 16 59167846 missense probably benign
R7642:Olfr196 UTSW 16 59167717 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGAGATGCAGGACGCACATAC -3'
(R):5'- AATGTTTTCTCTTGGCAGCAATGGC -3'

Sequencing Primer
(F):5'- AGATGGGCTCCACAGGTG -3'
(R):5'- AGCAATGGCCTATGATCGC -3'
Posted On2013-07-30