Incidental Mutation 'R0679:Or5h26'
ID 61732
Institutional Source Beutler Lab
Gene Symbol Or5h26
Ensembl Gene ENSMUSG00000096695
Gene Name olfactory receptor family 5 subfamily H member 26
Synonyms MOR183-1, Olfr196, GA_x54KRFPKG5P-55389051-55388122
MMRRC Submission 038864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0679 (G1)
Quality Score 134
Status Not validated
Chromosome 16
Chromosomal Location 58987010-58990817 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58987979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 176 (H176Y)
Ref Sequence ENSEMBL: ENSMUSP00000145684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077027] [ENSMUST00000205471] [ENSMUST00000207673]
AlphaFold E9PYP4
Predicted Effect probably damaging
Transcript: ENSMUST00000077027
AA Change: H176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076285
Gene: ENSMUSG00000096695
AA Change: H176Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7tm_1 41 290 1.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205471
AA Change: H176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207673
AA Change: H176Y
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,942,824 (GRCm39) D1507N probably damaging Het
Cplane1 G T 15: 8,252,606 (GRCm39) V1943L probably benign Het
Cry2 A G 2: 92,244,060 (GRCm39) I371T probably damaging Het
L3mbtl3 T A 10: 26,189,831 (GRCm39) K478* probably null Het
Plcg1 C T 2: 160,598,830 (GRCm39) P842S probably damaging Het
Ros1 T C 10: 51,942,391 (GRCm39) R2111G possibly damaging Het
Sox10 A G 15: 79,040,788 (GRCm39) S90P probably benign Het
Tbc1d32 A C 10: 56,056,672 (GRCm39) Y423D probably damaging Het
Utp15 A T 13: 98,395,911 (GRCm39) Y52N probably benign Het
Vps13b T G 15: 35,709,849 (GRCm39) I1932S possibly damaging Het
Zfp457 A T 13: 67,441,655 (GRCm39) C211S probably damaging Het
Other mutations in Or5h26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Or5h26 APN 16 58,987,891 (GRCm39) nonsense probably null
PIT4495001:Or5h26 UTSW 16 58,988,337 (GRCm39) missense possibly damaging 0.48
R0312:Or5h26 UTSW 16 58,988,202 (GRCm39) missense probably benign 0.00
R0345:Or5h26 UTSW 16 58,988,269 (GRCm39) missense possibly damaging 0.90
R0644:Or5h26 UTSW 16 58,987,979 (GRCm39) missense probably damaging 1.00
R1709:Or5h26 UTSW 16 58,988,264 (GRCm39) missense probably benign 0.03
R1818:Or5h26 UTSW 16 58,988,243 (GRCm39) missense probably benign 0.00
R2090:Or5h26 UTSW 16 58,988,503 (GRCm39) start codon destroyed probably null 0.99
R5327:Or5h26 UTSW 16 58,987,983 (GRCm39) missense possibly damaging 0.96
R5945:Or5h26 UTSW 16 58,988,482 (GRCm39) missense probably benign 0.42
R6093:Or5h26 UTSW 16 58,988,330 (GRCm39) missense probably damaging 1.00
R6268:Or5h26 UTSW 16 58,987,656 (GRCm39) splice site probably null
R6487:Or5h26 UTSW 16 58,988,536 (GRCm39) splice site probably null
R6628:Or5h26 UTSW 16 58,988,344 (GRCm39) missense probably benign 0.00
R6679:Or5h26 UTSW 16 58,988,209 (GRCm39) missense probably benign
R7642:Or5h26 UTSW 16 58,988,080 (GRCm39) missense probably benign 0.01
R8285:Or5h26 UTSW 16 58,988,176 (GRCm39) missense probably benign 0.35
R8336:Or5h26 UTSW 16 58,987,918 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGGAGATGCAGGACGCACATAC -3'
(R):5'- AATGTTTTCTCTTGGCAGCAATGGC -3'

Sequencing Primer
(F):5'- AGATGGGCTCCACAGGTG -3'
(R):5'- AGCAATGGCCTATGATCGC -3'
Posted On 2013-07-30