Incidental Mutation 'R8020:Atxn7l1'
ID617320
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R8020 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33325953 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 82 (A82V)
Ref Sequence ENSEMBL: ENSMUSP00000151520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000136644] [ENSMUST00000144586] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably benign
Transcript: ENSMUST00000090597
AA Change: A9V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: A9V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: A105V

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136644
AA Change: A82V

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect unknown
Transcript: ENSMUST00000144586
AA Change: R43C
Predicted Effect
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: A105V

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154742
AA Change: A9V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: A9V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,893,194 V32A probably benign Het
Atp8b1 A G 18: 64,546,013 L799S probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cubn A T 2: 13,479,178 D201E probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gng11 C T 6: 4,008,077 R47C probably damaging Het
Hyal4 T C 6: 24,755,996 V71A probably benign Het
Ighd A T 12: 113,414,548 S144T probably benign Het
Il2rb T C 15: 78,485,004 Y249C probably benign Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrrc27 C T 7: 139,236,877 S397L probably damaging Het
Ms4a6d T C 19: 11,590,108 E143G probably benign Het
Mtif3 A G 5: 146,958,903 Y125H probably damaging Het
Olfr570 A G 7: 102,901,265 I299M possibly damaging Het
Prkcd G A 14: 30,609,244 T58M possibly damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prpf6 T C 2: 181,645,570 F583L probably benign Het
Prrx1 T C 1: 163,248,262 N245S probably damaging Het
Rfc1 A T 5: 65,272,178 I922N probably damaging Het
Rplp0 T C 5: 115,560,844 V53A probably benign Het
Sis A G 3: 72,908,965 probably null Het
Slc12a1 T C 2: 125,178,102 F411S possibly damaging Het
Slc30a9 G T 5: 67,307,033 probably benign Het
Slc35d2 A G 13: 64,107,043 I207T probably benign Het
Tbc1d14 G T 5: 36,571,843 H60N probably benign Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Zfp981 A G 4: 146,537,368 D250G possibly damaging Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R0621:Atxn7l1 UTSW 12 33326100 missense probably benign 0.15
R1840:Atxn7l1 UTSW 12 33371033 unclassified probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R2369:Atxn7l1 UTSW 12 33358850 critical splice donor site probably null
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R3976:Atxn7l1 UTSW 12 33325955 missense probably damaging 1.00
R4151:Atxn7l1 UTSW 12 33364482 missense probably damaging 0.96
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5090:Atxn7l1 UTSW 12 33326078 missense probably damaging 1.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
R8057:Atxn7l1 UTSW 12 33326002 missense probably damaging 0.99
Z1176:Atxn7l1 UTSW 12 33367645 missense probably benign 0.00
Z1176:Atxn7l1 UTSW 12 33368017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTAAGTTGGCACTGACGG -3'
(R):5'- GGACTCACCATGGTTTATCCC -3'

Sequencing Primer
(F):5'- TTGGCACTGACGGCCAAC -3'
(R):5'- CTTGGTCCCTTTGCAGAGAAGAC -3'
Posted On2020-01-23