Incidental Mutation 'R8020:Il2rb'
ID617325
Institutional Source Beutler Lab
Gene Symbol Il2rb
Ensembl Gene ENSMUSG00000068227
Gene Nameinterleukin 2 receptor, beta chain
SynonymsIL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R8020 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78479256-78495271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78485004 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 249 (Y249C)
Ref Sequence ENSEMBL: ENSMUSP00000086820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089398] [ENSMUST00000163494]
Predicted Effect probably benign
Transcript: ENSMUST00000089398
AA Change: Y249C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: Y249C

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163494
AA Change: Y249C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: Y249C

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,893,194 V32A probably benign Het
Atp8b1 A G 18: 64,546,013 L799S probably damaging Het
Atxn7l1 C T 12: 33,325,953 A82V probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cubn A T 2: 13,479,178 D201E probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gng11 C T 6: 4,008,077 R47C probably damaging Het
Hyal4 T C 6: 24,755,996 V71A probably benign Het
Ighd A T 12: 113,414,548 S144T probably benign Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrrc27 C T 7: 139,236,877 S397L probably damaging Het
Ms4a6d T C 19: 11,590,108 E143G probably benign Het
Mtif3 A G 5: 146,958,903 Y125H probably damaging Het
Olfr570 A G 7: 102,901,265 I299M possibly damaging Het
Prkcd G A 14: 30,609,244 T58M possibly damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prpf6 T C 2: 181,645,570 F583L probably benign Het
Prrx1 T C 1: 163,248,262 N245S probably damaging Het
Rfc1 A T 5: 65,272,178 I922N probably damaging Het
Rplp0 T C 5: 115,560,844 V53A probably benign Het
Sis A G 3: 72,908,965 probably null Het
Slc12a1 T C 2: 125,178,102 F411S possibly damaging Het
Slc30a9 G T 5: 67,307,033 probably benign Het
Slc35d2 A G 13: 64,107,043 I207T probably benign Het
Tbc1d14 G T 5: 36,571,843 H60N probably benign Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Zfp981 A G 4: 146,537,368 D250G possibly damaging Het
Other mutations in Il2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Moonpie UTSW 15 78481834 frame shift probably null
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8477:Il2rb UTSW 15 78485806 missense probably damaging 1.00
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCTACCTGTGGGATGAGGC -3'
(R):5'- CTTTCTGGAAAGCTGGGCTG -3'

Sequencing Primer
(F):5'- CTGTGGGATGAGGCACAGG -3'
(R):5'- TGGGCTGGAGCAGGACTG -3'
Posted On2020-01-23