Incidental Mutation 'R8021:Mapk8ip1'
ID 617342
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Name mitogen-activated protein kinase 8 interacting protein 1
Synonyms Skip, IB1, Prkm8ip, MAPK8IP1, mjip-2a, JIP-1, Jip1
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 92214021-92231608 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92216760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 477 (S477T)
Ref Sequence ENSEMBL: ENSMUSP00000050773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
AlphaFold Q9WVI9
PDB Structure Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform complex with a biaryl tetrazol (A-82118) [X-RAY DIFFRACTION]
Structural and functional analysis of quercetagetin, a natural JNK1 inhibitor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050312
AA Change: S477T

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: S477T

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111279
AA Change: S468T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: S468T

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Adamts3 T C 5: 89,831,043 (GRCm39) K1004E possibly damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Ascc3 T A 10: 50,607,744 (GRCm39) M1416K probably benign Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Psip1 T C 4: 83,378,192 (GRCm39) T435A possibly damaging Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Tut1 T A 19: 8,932,873 (GRCm39) S69T probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vmn2r76 G A 7: 85,874,958 (GRCm39) T673I probably damaging Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92,215,533 (GRCm39) missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92,219,319 (GRCm39) critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92,216,220 (GRCm39) missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92,217,092 (GRCm39) missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92,216,958 (GRCm39) missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92,217,257 (GRCm39) missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92,216,289 (GRCm39) missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92,216,321 (GRCm39) splice site probably null
R0515:Mapk8ip1 UTSW 2 92,217,701 (GRCm39) missense possibly damaging 0.71
R2016:Mapk8ip1 UTSW 2 92,221,379 (GRCm39) critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92,221,379 (GRCm39) critical splice donor site probably null
R5141:Mapk8ip1 UTSW 2 92,217,110 (GRCm39) missense probably damaging 1.00
R5858:Mapk8ip1 UTSW 2 92,215,317 (GRCm39) missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6244:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6984:Mapk8ip1 UTSW 2 92,217,072 (GRCm39) missense probably damaging 1.00
R7471:Mapk8ip1 UTSW 2 92,219,489 (GRCm39) missense probably benign
R7588:Mapk8ip1 UTSW 2 92,216,984 (GRCm39) missense possibly damaging 0.77
R7810:Mapk8ip1 UTSW 2 92,219,496 (GRCm39) missense probably benign 0.05
R8975:Mapk8ip1 UTSW 2 92,215,166 (GRCm39) missense probably damaging 1.00
R9062:Mapk8ip1 UTSW 2 92,217,527 (GRCm39) missense probably damaging 1.00
R9267:Mapk8ip1 UTSW 2 92,216,714 (GRCm39) missense possibly damaging 0.46
R9306:Mapk8ip1 UTSW 2 92,219,428 (GRCm39) missense probably benign
R9569:Mapk8ip1 UTSW 2 92,217,599 (GRCm39) missense probably benign 0.00
R9729:Mapk8ip1 UTSW 2 92,217,060 (GRCm39) missense probably damaging 1.00
X0023:Mapk8ip1 UTSW 2 92,216,946 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTATAGTTCACGGCACCTCAGC -3'
(R):5'- GAGCCTGATGTCCACTTCTC -3'

Sequencing Primer
(F):5'- CAGCACTTTGTCACTAAGCTGAG -3'
(R):5'- AATGTCTTCATGAGTGGCCGC -3'
Posted On 2020-01-23