Incidental Mutation 'R8021:Ttc14'
ID617345
Institutional Source Beutler Lab
Gene Symbol Ttc14
Ensembl Gene ENSMUSG00000027677
Gene Nametetratricopeptide repeat domain 14
SynonymscI-44, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik, 4933402I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location33799832-33814860 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 33809121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 559 (Y559*)
Ref Sequence ENSEMBL: ENSMUSP00000112450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000196369] [ENSMUST00000196975] [ENSMUST00000198529] [ENSMUST00000199222] [ENSMUST00000200271]
Predicted Effect probably benign
Transcript: ENSMUST00000029222
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108210
AA Change: Y611*
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677
AA Change: Y611*

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117915
AA Change: Y559*
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677
AA Change: Y559*

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196369
SMART Domains Protein: ENSMUSP00000142863
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 21 105 7.28e-2 SMART
TPR 204 237 6.19e-1 SMART
TPR 238 271 2.11e-3 SMART
TPR 279 312 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196975
SMART Domains Protein: ENSMUSP00000142684
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 4.6e-4 SMART
TPR 254 287 3e-3 SMART
TPR 288 321 1e-5 SMART
TPR 329 362 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198529
SMART Domains Protein: ENSMUSP00000143073
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
Pfam:TPR_11 304 371 2.1e-12 PFAM
Pfam:TPR_2 306 339 1.9e-4 PFAM
Pfam:TPR_1 308 339 1.3e-4 PFAM
Pfam:TPR_1 340 373 2.9e-5 PFAM
Pfam:TPR_2 340 373 6.8e-4 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200271
SMART Domains Protein: ENSMUSP00000143738
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 120 204 7.28e-2 SMART
TPR 303 336 6.19e-1 SMART
TPR 337 370 2.11e-3 SMART
TPR 378 411 1.88e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Ttc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ttc14 APN 3 33803099 missense probably benign 0.35
IGL01326:Ttc14 APN 3 33801358 missense probably benign 0.14
R0196:Ttc14 UTSW 3 33809254 unclassified probably benign
R0427:Ttc14 UTSW 3 33803484 missense probably damaging 1.00
R1713:Ttc14 UTSW 3 33802920 missense probably damaging 1.00
R2312:Ttc14 UTSW 3 33807835 splice site probably null
R2434:Ttc14 UTSW 3 33801078 missense probably benign 0.40
R4794:Ttc14 UTSW 3 33803149 missense probably benign 0.00
R4825:Ttc14 UTSW 3 33801369 missense possibly damaging 0.88
R4888:Ttc14 UTSW 3 33806875 nonsense probably null
R5143:Ttc14 UTSW 3 33808901 unclassified probably benign
R6051:Ttc14 UTSW 3 33808924 unclassified probably benign
R6270:Ttc14 UTSW 3 33800388 missense possibly damaging 0.68
R6415:Ttc14 UTSW 3 33803575 missense possibly damaging 0.81
R6439:Ttc14 UTSW 3 33808819 unclassified probably benign
R7021:Ttc14 UTSW 3 33803497 missense probably damaging 0.99
R7571:Ttc14 UTSW 3 33809251 missense unknown
R7751:Ttc14 UTSW 3 33809441 missense unknown
R8388:Ttc14 UTSW 3 33800586 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATTGCTACCCAGTTCCAAC -3'
(R):5'- TCTGAACTTGCTGGTGAAGTAGAG -3'

Sequencing Primer
(F):5'- GATTGCTACCCAGTTCCAACTAATAC -3'
(R):5'- GAGTACTTCACAGAACTTGGCTC -3'
Posted On2020-01-23