Incidental Mutation 'R8021:Tars2'
ID617346
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Namethreonyl-tRNA synthetase 2, mitochondrial (putative)
SynonymsTarsl1, 2610024N01Rik
Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R8021 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95739976-95760206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95747514 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 393 (N393S)
Ref Sequence ENSEMBL: ENSMUSP00000029752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000199464] [ENSMUST00000199570]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
AA Change: N393S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: N393S

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
AA Change: N393S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: N393S

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098857
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163530
AA Change: N312S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: N312S

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195929
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196868
Predicted Effect probably benign
Transcript: ENSMUST00000197720
Predicted Effect probably benign
Transcript: ENSMUST00000198289
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199570
SMART Domains Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.5e-13 PFAM
tRNA_SAD 152 201 8.5e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95740278 missense probably damaging 1.00
IGL02523:Tars2 APN 3 95741393 missense probably damaging 1.00
IGL02709:Tars2 APN 3 95742071 splice site probably benign
IGL03286:Tars2 APN 3 95754755 splice site probably benign
IGL03348:Tars2 APN 3 95740268 unclassified probably null
B6584:Tars2 UTSW 3 95742150 unclassified probably null
R0548:Tars2 UTSW 3 95742659 missense probably damaging 1.00
R0657:Tars2 UTSW 3 95748557 missense probably benign 0.00
R1955:Tars2 UTSW 3 95747454 missense probably damaging 1.00
R2070:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R2071:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R3025:Tars2 UTSW 3 95747640 missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95754756 critical splice donor site probably null
R4676:Tars2 UTSW 3 95753091 missense probably damaging 1.00
R4775:Tars2 UTSW 3 95746647 missense probably damaging 1.00
R5208:Tars2 UTSW 3 95747593 missense probably damaging 1.00
R5512:Tars2 UTSW 3 95750416 missense probably damaging 1.00
R5894:Tars2 UTSW 3 95747652 unclassified probably null
R5965:Tars2 UTSW 3 95748152 splice site probably null
R6381:Tars2 UTSW 3 95754487 nonsense probably null
R6953:Tars2 UTSW 3 95753114 missense possibly damaging 0.63
R7042:Tars2 UTSW 3 95750745 missense probably benign 0.00
R7648:Tars2 UTSW 3 95750982 missense probably benign 0.26
R7877:Tars2 UTSW 3 95746089 missense probably damaging 0.99
R7960:Tars2 UTSW 3 95746089 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGCCTCAATATTCTTTCCAAGG -3'
(R):5'- TCAGCATGGTCTGAACCCAC -3'

Sequencing Primer
(F):5'- CCTAGAACTAGCTTTGTAGACCAGG -3'
(R):5'- TGGTCTGAACCCACAAGAGGATC -3'
Posted On2020-01-23