Incidental Mutation 'R8021:Psip1'
ID 617348
Institutional Source Beutler Lab
Gene Symbol Psip1
Ensembl Gene ENSMUSG00000028484
Gene Name PC4 and SFRS1 interacting protein 1
Synonyms Psip2
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.513) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 83373917-83404696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83378192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 435 (T435A)
Ref Sequence ENSEMBL: ENSMUSP00000030207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030207] [ENSMUST00000107214] [ENSMUST00000107215] [ENSMUST00000123262] [ENSMUST00000124856] [ENSMUST00000143533]
AlphaFold Q99JF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000030207
AA Change: T435A

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030207
Gene: ENSMUSG00000028484
AA Change: T435A

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
Pfam:LEDGF 347 448 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107214
SMART Domains Protein: ENSMUSP00000102832
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107215
SMART Domains Protein: ENSMUSP00000102833
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 316 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123262
SMART Domains Protein: ENSMUSP00000124038
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124856
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126706
SMART Domains Protein: ENSMUSP00000120799
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143533
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene tend to die perinatally. Survivors show reduced fertility and a variety of skeletal and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Adamts3 T C 5: 89,831,043 (GRCm39) K1004E possibly damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Ascc3 T A 10: 50,607,744 (GRCm39) M1416K probably benign Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,216,760 (GRCm39) S477T possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Tut1 T A 19: 8,932,873 (GRCm39) S69T probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vmn2r76 G A 7: 85,874,958 (GRCm39) T673I probably damaging Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Psip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Psip1 APN 4 83,386,874 (GRCm39) missense probably benign 0.00
IGL02801:Psip1 APN 4 83,376,357 (GRCm39) missense probably benign 0.02
IGL02995:Psip1 APN 4 83,381,954 (GRCm39) intron probably benign
IGL03070:Psip1 APN 4 83,383,318 (GRCm39) missense probably damaging 0.99
IGL03381:Psip1 APN 4 83,404,022 (GRCm39) missense probably benign 0.03
R0167:Psip1 UTSW 4 83,385,055 (GRCm39) splice site probably null
R0288:Psip1 UTSW 4 83,383,196 (GRCm39) missense probably damaging 1.00
R0365:Psip1 UTSW 4 83,403,949 (GRCm39) splice site probably null
R0514:Psip1 UTSW 4 83,378,274 (GRCm39) missense probably damaging 1.00
R0590:Psip1 UTSW 4 83,376,381 (GRCm39) missense probably benign 0.00
R0734:Psip1 UTSW 4 83,381,825 (GRCm39) intron probably benign
R0774:Psip1 UTSW 4 83,378,689 (GRCm39) frame shift probably null
R1016:Psip1 UTSW 4 83,378,135 (GRCm39) missense possibly damaging 0.48
R1256:Psip1 UTSW 4 83,392,604 (GRCm39) missense probably benign
R1819:Psip1 UTSW 4 83,376,400 (GRCm39) missense probably benign 0.01
R1993:Psip1 UTSW 4 83,400,769 (GRCm39) missense probably damaging 0.99
R5423:Psip1 UTSW 4 83,378,367 (GRCm39) intron probably benign
R5940:Psip1 UTSW 4 83,394,559 (GRCm39) missense probably damaging 1.00
R6173:Psip1 UTSW 4 83,391,286 (GRCm39) splice site probably null
R6200:Psip1 UTSW 4 83,392,610 (GRCm39) missense probably benign 0.20
R6809:Psip1 UTSW 4 83,386,879 (GRCm39) missense probably benign 0.00
R7488:Psip1 UTSW 4 83,391,275 (GRCm39) critical splice donor site probably null
R8516:Psip1 UTSW 4 83,384,952 (GRCm39) missense probably benign
R9564:Psip1 UTSW 4 83,386,888 (GRCm39) missense possibly damaging 0.80
RF005:Psip1 UTSW 4 83,378,735 (GRCm39) missense probably damaging 1.00
RF024:Psip1 UTSW 4 83,378,735 (GRCm39) missense probably damaging 1.00
Z1176:Psip1 UTSW 4 83,378,111 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCCTTACTGAGAGAGGTTCCTTC -3'
(R):5'- GCAACGCTAACATCGTTTCTC -3'

Sequencing Primer
(F):5'- ACTGAGAGAGGTTCCTTCATTTC -3'
(R):5'- ACATCGTTTCTCAGTTCACCAAAG -3'
Posted On 2020-01-23