Mutagenetix > Incidental Mutation

Incidental Mutation 'R8021:Adamts3'

617357

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89683184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1004 (K1004E)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061427
AA Change: K1003E

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: K1003E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163159
AA Change: K1004E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: K1004E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.1661

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	A	G	11: 107,025,927	I12V	unknown	Het
9130011E15Rik	C	T	19: 45,956,741		probably null	Het
A630010A05Rik	C	T	16: 14,589,246	T13I		Het
Acsm5	A	G	7: 119,542,393	E537G	possibly damaging	Het
Adam25	C	A	8: 40,754,759	A354E	probably damaging	Het
Ap3d1	C	A	10: 80,714,301	V699L	probably benign	Het
Arel1	T	G	12: 84,934,958	H216P	possibly damaging	Het
Armc12	T	A	17: 28,530,905	F8I	probably benign	Het
Ascc3	T	A	10: 50,731,648	M1416K	probably benign	Het
Catsperb	A	C	12: 101,588,063	N672T	probably benign	Het
Ccdc30	T	C	4: 119,352,679	H291R	probably benign	Het
Cd33	A	G	7: 43,528,838	V371A	unknown	Het
Cpt1b	A	T	15: 89,421,426	M362K	probably benign	Het
Dusp5	T	A	19: 53,529,498	S61T	probably benign	Het
Eogt	T	G	6: 97,134,330	D190A	probably damaging	Het
Fat3	T	A	9: 15,999,109	I1866F	probably damaging	Het
Fer1l4	T	A	2: 156,022,591	I1668F	probably damaging	Het
Foxn3	A	T	12: 99,388,902	M1K	probably null	Het
Frs3	T	A	17: 47,703,114	V244E	probably damaging	Het
Gm8765	A	G	13: 50,701,094	N256S	possibly damaging	Het
Grik1	C	T	16: 87,914,222	V832I		Het
Gtf2ird2	T	A	5: 134,203,334	V242E	probably benign	Het
Gtpbp2	C	T	17: 46,164,269	R97C	possibly damaging	Het
Habp2	T	A	19: 56,314,053	V263E	probably benign	Het
Iars2	T	A	1: 185,322,457	I337L	probably benign	Het
Ifi204	T	C	1: 173,759,353		probably benign	Het
Itih2	T	C	2: 10,105,652	T543A	probably benign	Het
Kdm2b	A	G	5: 122,932,919	S372P	probably damaging	Het
Kit	T	A	5: 75,615,491	V311E	possibly damaging	Het
Kmt2c	C	G	5: 25,287,119	V4230L	possibly damaging	Het
Lao1	T	C	4: 118,968,477	I498T	probably damaging	Het
Lrp1	G	T	10: 127,548,346	D3641E	possibly damaging	Het
Mapk8ip1	A	T	2: 92,386,415	S477T	possibly damaging	Het
Mast3	C	T	8: 70,788,252	G218S	probably benign	Het
Mical1	T	C	10: 41,482,724	V546A	probably damaging	Het
Nck2	T	C	1: 43,554,260	V209A	probably benign	Het
Ndufs4	A	G	13: 114,307,815		probably null	Het
Nek3	C	T	8: 22,157,190	V139M	probably damaging	Het
Olfr1417	T	C	19: 11,828,892	I45V	probably benign	Het
Olfr863-ps1	A	C	9: 19,942,079	Y120*	probably null	Het
Olfr877	T	A	9: 37,855,296	H159Q	probably damaging	Het
Olfr994	A	T	2: 85,430,652	M59K	probably damaging	Het
Otog	A	T	7: 46,267,342	N901I	probably damaging	Het
Pclo	A	C	5: 14,539,784	Q699H	unknown	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pde12	A	T	14: 26,665,699	Y551*	probably null	Het
Pigg	A	G	5: 108,319,939	D268G	probably damaging	Het
Ppp1r21	A	G	17: 88,549,507	D130G	probably benign	Het
Psip1	T	C	4: 83,459,955	T435A	possibly damaging	Het
Rad54l2	T	C	9: 106,719,641	S189G	probably benign	Het
Rgs14	T	C	13: 55,383,756	C498R	probably damaging	Het
Ripply3	C	A	16: 94,328,510	A5E	probably benign	Het
Rps6ka4	T	C	19: 6,830,409	D676G	probably benign	Het
Rsbn1	T	C	3: 103,928,582	L312S	possibly damaging	Het
Secisbp2	T	A	13: 51,665,628	*415R	probably null	Het
Sephs1	T	A	2: 4,906,623	F336Y	probably benign	Het
Setdb2	A	T	14: 59,423,384	Y103*	probably null	Het
Slit2	T	A	5: 48,302,492	C1371*	probably null	Het
Stab2	C	T	10: 86,905,539	A1239T	possibly damaging	Het
Taf4b	T	A	18: 14,804,524	V218E	probably damaging	Het
Tars2	T	C	3: 95,747,514	N393S	probably benign	Het
Tbc1d30	A	G	10: 121,267,543	M528T	probably benign	Het
Tchp	A	G	5: 114,718,417	E363G	probably damaging	Het
Tec	T	A	5: 72,757,469	N568I	probably benign	Het
Ticam1	A	G	17: 56,270,089	S669P	unknown	Het
Tnk1	A	G	11: 69,854,984	S372P	probably benign	Het
Tnpo2	G	A	8: 85,055,206	A847T	probably damaging	Het
Tsc1	A	T	2: 28,686,889	I1068F	possibly damaging	Het
Ttc14	T	A	3: 33,809,121	Y559*	probably null	Het
Ttc41	C	A	10: 86,733,714	T652N	probably benign	Het
Tut1	T	A	19: 8,955,509	S69T	probably benign	Het
Uck1	T	C	2: 32,259,917	S40G	probably benign	Het
Vmn2r76	G	A	7: 86,225,750	T673I	probably damaging	Het
Vps13d	G	T	4: 145,148,675	P1760H		Het
Zbp1	T	C	2: 173,209,210	N289S	possibly damaging	Het
Zc3hav1l	C	A	6: 38,297,947		probably benign	Het
Zzef1	A	T	11: 72,823,416	D244V	probably damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGCCCTATTTCAAACAGCATTC -3'
(R):5'- TGGCCTCAGAATCTCTGTACG -3'

Sequencing Primer
(F):5'- CTCAGACTATTATTTCCAAAGGTGTC -3'
(R):5'- ACTCCAGAGTTGTCAAGTGG -3'

Posted On

2020-01-23