Incidental Mutation 'R8021:Adamts3'
ID 617357
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89831043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1004 (K1004E)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect possibly damaging
Transcript: ENSMUST00000061427
AA Change: K1003E

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: K1003E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163159
AA Change: K1004E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: K1004E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Meta Mutation Damage Score 0.1661 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Ascc3 T A 10: 50,607,744 (GRCm39) M1416K probably benign Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,216,760 (GRCm39) S477T possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Psip1 T C 4: 83,378,192 (GRCm39) T435A possibly damaging Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Tut1 T A 19: 8,932,873 (GRCm39) S69T probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vmn2r76 G A 7: 85,874,958 (GRCm39) T673I probably damaging Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCCTATTTCAAACAGCATTC -3'
(R):5'- TGGCCTCAGAATCTCTGTACG -3'

Sequencing Primer
(F):5'- CTCAGACTATTATTTCCAAAGGTGTC -3'
(R):5'- ACTCCAGAGTTGTCAAGTGG -3'
Posted On 2020-01-23