Incidental Mutation 'R8021:Vmn2r76'
ID 617365
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Name vomeronasal 2, receptor 76
Synonyms
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85874414-85895409 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85874958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 673 (T673I)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
AlphaFold E9Q3F5
Predicted Effect probably damaging
Transcript: ENSMUST00000165771
AA Change: T673I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: T673I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Adamts3 T C 5: 89,831,043 (GRCm39) K1004E possibly damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Ascc3 T A 10: 50,607,744 (GRCm39) M1416K probably benign Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,216,760 (GRCm39) S477T possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Psip1 T C 4: 83,378,192 (GRCm39) T435A possibly damaging Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Tut1 T A 19: 8,932,873 (GRCm39) S69T probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 85,877,925 (GRCm39) missense probably benign
IGL01374:Vmn2r76 APN 7 85,874,857 (GRCm39) missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 85,874,910 (GRCm39) missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 85,874,871 (GRCm39) missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 85,879,406 (GRCm39) missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 85,877,925 (GRCm39) missense probably benign
IGL02214:Vmn2r76 APN 7 85,879,138 (GRCm39) missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 85,878,071 (GRCm39) missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 85,879,356 (GRCm39) missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 85,877,961 (GRCm39) nonsense probably null
IGL02598:Vmn2r76 APN 7 85,877,879 (GRCm39) missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 85,874,914 (GRCm39) missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 85,879,495 (GRCm39) missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 85,879,034 (GRCm39) missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 85,874,959 (GRCm39) missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 85,877,987 (GRCm39) missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 85,879,506 (GRCm39) missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 85,875,323 (GRCm39) critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 85,879,578 (GRCm39) missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 85,877,904 (GRCm39) missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 85,879,454 (GRCm39) missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 85,879,356 (GRCm39) missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 85,880,464 (GRCm39) missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 85,880,219 (GRCm39) missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 85,879,692 (GRCm39) missense probably benign
R2181:Vmn2r76 UTSW 7 85,874,743 (GRCm39) missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 85,879,707 (GRCm39) missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 85,875,201 (GRCm39) missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 85,874,959 (GRCm39) missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 85,874,763 (GRCm39) missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 85,875,244 (GRCm39) missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 85,880,415 (GRCm39) missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 85,879,508 (GRCm39) missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 85,879,740 (GRCm39) missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 85,877,511 (GRCm39) missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 85,879,652 (GRCm39) missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 85,874,733 (GRCm39) missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 85,877,915 (GRCm39) missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 85,875,267 (GRCm39) missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 85,874,496 (GRCm39) missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 85,874,657 (GRCm39) missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 85,875,286 (GRCm39) missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 85,875,261 (GRCm39) missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 85,895,202 (GRCm39) critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 85,879,142 (GRCm39) missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 85,877,469 (GRCm39) nonsense probably null
R6651:Vmn2r76 UTSW 7 85,878,059 (GRCm39) missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 85,879,560 (GRCm39) missense probably benign
R6750:Vmn2r76 UTSW 7 85,875,114 (GRCm39) missense probably damaging 1.00
R7082:Vmn2r76 UTSW 7 85,874,440 (GRCm39) missense probably benign 0.01
R7136:Vmn2r76 UTSW 7 85,877,975 (GRCm39) missense probably benign 0.06
R7524:Vmn2r76 UTSW 7 85,879,374 (GRCm39) missense probably benign 0.00
R7524:Vmn2r76 UTSW 7 85,874,577 (GRCm39) missense probably benign 0.22
R7611:Vmn2r76 UTSW 7 85,879,388 (GRCm39) missense probably benign 0.04
R7833:Vmn2r76 UTSW 7 85,877,892 (GRCm39) missense probably benign
R8002:Vmn2r76 UTSW 7 85,879,271 (GRCm39) missense probably benign 0.05
R8023:Vmn2r76 UTSW 7 85,879,028 (GRCm39) missense probably benign 0.00
R8250:Vmn2r76 UTSW 7 85,875,231 (GRCm39) missense possibly damaging 0.82
R8428:Vmn2r76 UTSW 7 85,874,479 (GRCm39) missense possibly damaging 0.63
R8874:Vmn2r76 UTSW 7 85,877,999 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r76 UTSW 7 85,879,170 (GRCm39) missense probably benign 0.02
R9357:Vmn2r76 UTSW 7 85,880,428 (GRCm39) missense probably benign 0.43
Z1176:Vmn2r76 UTSW 7 85,895,271 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGCAATAACTGAACCTTTGTTGC -3'
(R):5'- AGACACTCCCATTGTCAAGGC -3'

Sequencing Primer
(F):5'- ATGACCATGTTCAATATGCCCATC -3'
(R):5'- TTGTCAAGGCCAATAACCGAG -3'
Posted On 2020-01-23