Incidental Mutation 'R8021:Tnpo2'
ID617370
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Nametransportin 2 (importin 3, karyopherin beta 2b)
SynonymsKpnb2b, TRN2, 1110034O24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85036915-85057583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85055206 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 847 (A847T)
Ref Sequence ENSEMBL: ENSMUSP00000091051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000095220] [ENSMUST00000166592] [ENSMUST00000211601]
Predicted Effect probably damaging
Transcript: ENSMUST00000093360
AA Change: A847T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691
AA Change: A847T

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095220
SMART Domains Protein: ENSMUSP00000092845
Gene: ENSMUSG00000008167

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
FBOX 82 123 7.47e-4 SMART
WD40 161 201 2.98e-1 SMART
WD40 210 252 4.55e-3 SMART
WD40 256 292 7.8e-2 SMART
WD40 296 333 1.03e0 SMART
WD40 377 415 2.57e0 SMART
Blast:WD40 419 455 8e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166592
AA Change: A847T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: A847T

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211601
AA Change: A837T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.5992 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85045317 critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85055171 splice site probably null
R3871:Tnpo2 UTSW 8 85054751 missense probably null 0.98
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85050025 missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85055078 missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85047137 missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85055022 missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85055034 missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85044415 missense probably benign 0.01
R8004:Tnpo2 UTSW 8 85044699 missense probably benign 0.26
R8042:Tnpo2 UTSW 8 85051559 missense probably damaging 1.00
R8403:Tnpo2 UTSW 8 85047297 missense probably benign 0.02
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACGTCCCTTAGGAACATCC -3'
(R):5'- GGGAACTGCTCTGAGAACTG -3'

Sequencing Primer
(F):5'- TCCCTTAGGAACATCCGGGAC -3'
(R):5'- GAACTGCTCTGAGAACTGTTGCC -3'
Posted On2020-01-23