Incidental Mutation 'R8021:Rad54l2'
ID617374
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106719641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 189 (S189G)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably benign
Transcript: ENSMUST00000046502
AA Change: S189G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: S189G

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190363
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8084:Rad54l2 UTSW 9 106713502 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGTTACTGTGAGCTCCAGG -3'
(R):5'- GCACTTGGAAATACGTTTGAGC -3'

Sequencing Primer
(F):5'- TCCAGGCTAGACTACAGGG -3'
(R):5'- GATGATTACACTCAGGTCTCCAGG -3'
Posted On2020-01-23