Incidental Mutation 'R8021:Ascc3'
ID 617376
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Name activating signal cointegrator 1 complex subunit 3
Synonyms Helic1, B630009I04Rik, ASC1p200
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 50468756-50727300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50607744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1416 (M1416K)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
AlphaFold E9PZJ8
Predicted Effect probably benign
Transcript: ENSMUST00000035606
AA Change: M1416K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: M1416K

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Adamts3 T C 5: 89,831,043 (GRCm39) K1004E possibly damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,216,760 (GRCm39) S477T possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Psip1 T C 4: 83,378,192 (GRCm39) T435A possibly damaging Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Tut1 T A 19: 8,932,873 (GRCm39) S69T probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vmn2r76 G A 7: 85,874,958 (GRCm39) T673I probably damaging Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50,590,531 (GRCm39) missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50,576,039 (GRCm39) nonsense probably null
IGL00897:Ascc3 APN 10 50,604,187 (GRCm39) missense probably benign 0.01
IGL01077:Ascc3 APN 10 50,525,413 (GRCm39) splice site probably benign
IGL01124:Ascc3 APN 10 50,608,569 (GRCm39) missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50,626,618 (GRCm39) missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50,566,235 (GRCm39) missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50,726,623 (GRCm39) nonsense probably null
IGL02247:Ascc3 APN 10 50,526,686 (GRCm39) missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50,604,250 (GRCm39) nonsense probably null
IGL02428:Ascc3 APN 10 50,721,791 (GRCm39) nonsense probably null
IGL02432:Ascc3 APN 10 50,576,589 (GRCm39) missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50,576,695 (GRCm39) missense probably benign 0.00
IGL02640:Ascc3 APN 10 50,643,470 (GRCm39) missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50,536,769 (GRCm39) missense probably benign 0.01
IGL03144:Ascc3 APN 10 50,643,539 (GRCm39) missense probably benign 0.16
IGL03161:Ascc3 APN 10 50,494,168 (GRCm39) missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50,699,949 (GRCm39) missense possibly damaging 0.89
algorithm UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
heuristic UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
network UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50,484,089 (GRCm39) missense probably benign 0.31
R0165:Ascc3 UTSW 10 50,718,223 (GRCm39) splice site probably null
R0255:Ascc3 UTSW 10 50,521,154 (GRCm39) missense probably benign 0.00
R0310:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0314:Ascc3 UTSW 10 50,514,095 (GRCm39) missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50,625,051 (GRCm39) splice site probably benign
R0418:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0419:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0421:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0480:Ascc3 UTSW 10 50,611,348 (GRCm39) missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R0833:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R1231:Ascc3 UTSW 10 50,699,756 (GRCm39) missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50,518,615 (GRCm39) splice site probably benign
R1302:Ascc3 UTSW 10 50,480,890 (GRCm39) start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50,576,586 (GRCm39) missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50,566,257 (GRCm39) missense probably benign 0.00
R1855:Ascc3 UTSW 10 50,494,018 (GRCm39) missense probably benign 0.01
R1953:Ascc3 UTSW 10 50,721,726 (GRCm39) missense probably benign
R1976:Ascc3 UTSW 10 50,525,262 (GRCm39) missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50,493,838 (GRCm39) missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50,525,908 (GRCm39) missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50,566,307 (GRCm39) missense probably benign 0.00
R2040:Ascc3 UTSW 10 50,604,227 (GRCm39) missense probably benign
R2043:Ascc3 UTSW 10 50,576,616 (GRCm39) missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50,597,935 (GRCm39) missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50,630,148 (GRCm39) missense probably benign 0.07
R2310:Ascc3 UTSW 10 50,624,988 (GRCm39) missense probably benign 0.15
R2405:Ascc3 UTSW 10 50,607,774 (GRCm39) missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50,494,297 (GRCm39) missense probably benign 0.14
R3410:Ascc3 UTSW 10 50,576,196 (GRCm39) missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50,494,281 (GRCm39) missense probably benign 0.00
R3771:Ascc3 UTSW 10 50,596,814 (GRCm39) splice site probably benign
R3783:Ascc3 UTSW 10 50,604,350 (GRCm39) missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50,597,981 (GRCm39) missense probably benign 0.14
R4509:Ascc3 UTSW 10 50,718,339 (GRCm39) missense probably benign 0.00
R4520:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4521:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4522:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4524:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4581:Ascc3 UTSW 10 50,587,121 (GRCm39) missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50,596,760 (GRCm39) missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50,535,110 (GRCm39) missense probably benign 0.02
R4768:Ascc3 UTSW 10 50,576,595 (GRCm39) missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50,589,329 (GRCm39) missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50,625,227 (GRCm39) missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50,699,894 (GRCm39) missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50,699,744 (GRCm39) missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50,514,059 (GRCm39) missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50,592,757 (GRCm39) missense probably benign 0.00
R5302:Ascc3 UTSW 10 50,583,873 (GRCm39) missense probably benign 0.09
R5436:Ascc3 UTSW 10 50,535,079 (GRCm39) missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50,725,679 (GRCm39) missense probably benign 0.06
R5474:Ascc3 UTSW 10 50,725,634 (GRCm39) missense probably benign 0.25
R5744:Ascc3 UTSW 10 50,586,977 (GRCm39) missense probably benign
R5781:Ascc3 UTSW 10 50,514,074 (GRCm39) missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5868:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5869:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6109:Ascc3 UTSW 10 50,525,343 (GRCm39) missense probably benign 0.37
R6122:Ascc3 UTSW 10 50,494,021 (GRCm39) missense probably benign
R6128:Ascc3 UTSW 10 50,526,734 (GRCm39) missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50,596,769 (GRCm39) missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50,721,676 (GRCm39) missense probably benign 0.09
R6472:Ascc3 UTSW 10 50,596,783 (GRCm39) missense probably benign 0.03
R6474:Ascc3 UTSW 10 50,624,932 (GRCm39) missense probably benign 0.01
R6480:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6572:Ascc3 UTSW 10 50,566,343 (GRCm39) nonsense probably null
R6585:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6656:Ascc3 UTSW 10 50,526,021 (GRCm39) nonsense probably null
R6669:Ascc3 UTSW 10 50,716,469 (GRCm39) missense probably benign
R6675:Ascc3 UTSW 10 50,626,659 (GRCm39) nonsense probably null
R6790:Ascc3 UTSW 10 50,521,808 (GRCm39) missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50,625,158 (GRCm39) missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50,725,742 (GRCm39) missense probably null 0.51
R6919:Ascc3 UTSW 10 50,521,849 (GRCm39) nonsense probably null
R6936:Ascc3 UTSW 10 50,606,057 (GRCm39) missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50,521,762 (GRCm39) missense probably benign 0.00
R6957:Ascc3 UTSW 10 50,604,278 (GRCm39) missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50,592,725 (GRCm39) missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50,716,446 (GRCm39) missense probably benign 0.43
R7358:Ascc3 UTSW 10 50,590,448 (GRCm39) nonsense probably null
R7479:Ascc3 UTSW 10 50,525,895 (GRCm39) missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50,721,796 (GRCm39) missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50,604,393 (GRCm39) missense probably benign 0.04
R8134:Ascc3 UTSW 10 50,643,554 (GRCm39) missense probably benign 0.02
R8252:Ascc3 UTSW 10 50,518,706 (GRCm39) missense probably benign
R8348:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8351:Ascc3 UTSW 10 50,725,693 (GRCm39) missense probably benign
R8356:Ascc3 UTSW 10 50,526,003 (GRCm39) missense probably benign 0.38
R8362:Ascc3 UTSW 10 50,518,692 (GRCm39) missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50,525,400 (GRCm39) missense possibly damaging 0.93
R8448:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8957:Ascc3 UTSW 10 50,576,208 (GRCm39) missense probably damaging 1.00
R9004:Ascc3 UTSW 10 50,718,276 (GRCm39) missense probably benign
R9133:Ascc3 UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R9200:Ascc3 UTSW 10 50,521,787 (GRCm39) missense possibly damaging 0.55
R9328:Ascc3 UTSW 10 50,535,015 (GRCm39) missense probably damaging 1.00
R9377:Ascc3 UTSW 10 50,608,858 (GRCm39) missense possibly damaging 0.62
R9412:Ascc3 UTSW 10 50,525,230 (GRCm39) missense probably benign 0.00
R9576:Ascc3 UTSW 10 50,494,254 (GRCm39) missense possibly damaging 0.71
R9796:Ascc3 UTSW 10 50,608,801 (GRCm39) nonsense probably null
X0021:Ascc3 UTSW 10 50,576,686 (GRCm39) missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50,526,692 (GRCm39) missense probably benign 0.00
X0026:Ascc3 UTSW 10 50,608,574 (GRCm39) missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50,594,517 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTAATGCAGCTGTTTCATTTCAGAA -3'
(R):5'- TTCCTTTAAAGAGCAGAGGGG -3'

Sequencing Primer
(F):5'- CAGAAACATTTCAAGTGATAGCAGC -3'
(R):5'- GTCCAAGAGACTTAATGTGCTACAG -3'
Posted On 2020-01-23