Mutagenetix > Incidental Mutation

Incidental Mutation 'R8021:Ap3d1'

617377

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

067460-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R8021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80714301 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 699 (V699L)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

AlphaFold

O54774

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: V699L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: V699L

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	A	G	11: 107,025,927	I12V	unknown	Het
9130011E15Rik	C	T	19: 45,956,741		probably null	Het
A630010A05Rik	C	T	16: 14,589,246	T13I		Het
Acsm5	A	G	7: 119,542,393	E537G	possibly damaging	Het
Adam25	C	A	8: 40,754,759	A354E	probably damaging	Het
Adamts3	T	C	5: 89,683,184	K1004E	possibly damaging	Het
Arel1	T	G	12: 84,934,958	H216P	possibly damaging	Het
Armc12	T	A	17: 28,530,905	F8I	probably benign	Het
Ascc3	T	A	10: 50,731,648	M1416K	probably benign	Het
Catsperb	A	C	12: 101,588,063	N672T	probably benign	Het
Ccdc30	T	C	4: 119,352,679	H291R	probably benign	Het
Cd33	A	G	7: 43,528,838	V371A	unknown	Het
Cpt1b	A	T	15: 89,421,426	M362K	probably benign	Het
Dusp5	T	A	19: 53,529,498	S61T	probably benign	Het
Eogt	T	G	6: 97,134,330	D190A	probably damaging	Het
Fat3	T	A	9: 15,999,109	I1866F	probably damaging	Het
Fer1l4	T	A	2: 156,022,591	I1668F	probably damaging	Het
Foxn3	A	T	12: 99,388,902	M1K	probably null	Het
Frs3	T	A	17: 47,703,114	V244E	probably damaging	Het
Gm8765	A	G	13: 50,701,094	N256S	possibly damaging	Het
Grik1	C	T	16: 87,914,222	V832I		Het
Gtf2ird2	T	A	5: 134,203,334	V242E	probably benign	Het
Gtpbp2	C	T	17: 46,164,269	R97C	possibly damaging	Het
Habp2	T	A	19: 56,314,053	V263E	probably benign	Het
Iars2	T	A	1: 185,322,457	I337L	probably benign	Het
Ifi204	T	C	1: 173,759,353		probably benign	Het
Itih2	T	C	2: 10,105,652	T543A	probably benign	Het
Kdm2b	A	G	5: 122,932,919	S372P	probably damaging	Het
Kit	T	A	5: 75,615,491	V311E	possibly damaging	Het
Kmt2c	C	G	5: 25,287,119	V4230L	possibly damaging	Het
Lao1	T	C	4: 118,968,477	I498T	probably damaging	Het
Lrp1	G	T	10: 127,548,346	D3641E	possibly damaging	Het
Mapk8ip1	A	T	2: 92,386,415	S477T	possibly damaging	Het
Mast3	C	T	8: 70,788,252	G218S	probably benign	Het
Mical1	T	C	10: 41,482,724	V546A	probably damaging	Het
Nck2	T	C	1: 43,554,260	V209A	probably benign	Het
Ndufs4	A	G	13: 114,307,815		probably null	Het
Nek3	C	T	8: 22,157,190	V139M	probably damaging	Het
Olfr1417	T	C	19: 11,828,892	I45V	probably benign	Het
Olfr863-ps1	A	C	9: 19,942,079	Y120*	probably null	Het
Olfr877	T	A	9: 37,855,296	H159Q	probably damaging	Het
Olfr994	A	T	2: 85,430,652	M59K	probably damaging	Het
Otog	A	T	7: 46,267,342	N901I	probably damaging	Het
Pclo	A	C	5: 14,539,784	Q699H	unknown	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pde12	A	T	14: 26,665,699	Y551*	probably null	Het
Pigg	A	G	5: 108,319,939	D268G	probably damaging	Het
Ppp1r21	A	G	17: 88,549,507	D130G	probably benign	Het
Psip1	T	C	4: 83,459,955	T435A	possibly damaging	Het
Rad54l2	T	C	9: 106,719,641	S189G	probably benign	Het
Rgs14	T	C	13: 55,383,756	C498R	probably damaging	Het
Ripply3	C	A	16: 94,328,510	A5E	probably benign	Het
Rps6ka4	T	C	19: 6,830,409	D676G	probably benign	Het
Rsbn1	T	C	3: 103,928,582	L312S	possibly damaging	Het
Secisbp2	T	A	13: 51,665,628	*415R	probably null	Het
Sephs1	T	A	2: 4,906,623	F336Y	probably benign	Het
Setdb2	A	T	14: 59,423,384	Y103*	probably null	Het
Slit2	T	A	5: 48,302,492	C1371*	probably null	Het
Stab2	C	T	10: 86,905,539	A1239T	possibly damaging	Het
Taf4b	T	A	18: 14,804,524	V218E	probably damaging	Het
Tars2	T	C	3: 95,747,514	N393S	probably benign	Het
Tbc1d30	A	G	10: 121,267,543	M528T	probably benign	Het
Tchp	A	G	5: 114,718,417	E363G	probably damaging	Het
Tec	T	A	5: 72,757,469	N568I	probably benign	Het
Ticam1	A	G	17: 56,270,089	S669P	unknown	Het
Tnk1	A	G	11: 69,854,984	S372P	probably benign	Het
Tnpo2	G	A	8: 85,055,206	A847T	probably damaging	Het
Tsc1	A	T	2: 28,686,889	I1068F	possibly damaging	Het
Ttc14	T	A	3: 33,809,121	Y559*	probably null	Het
Ttc41	C	A	10: 86,733,714	T652N	probably benign	Het
Tut1	T	A	19: 8,955,509	S69T	probably benign	Het
Uck1	T	C	2: 32,259,917	S40G	probably benign	Het
Vmn2r76	G	A	7: 86,225,750	T673I	probably damaging	Het
Vps13d	G	T	4: 145,148,675	P1760H		Het
Zbp1	T	C	2: 173,209,210	N289S	possibly damaging	Het
Zc3hav1l	C	A	6: 38,297,947		probably benign	Het
Zzef1	A	T	11: 72,823,416	D244V	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
Particle	UTSW	10	80710494	splice site	probably null
vesicle	UTSW	10	80723827	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80716591	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80712118	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80709793	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80719084	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80723827	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80709821	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80709228	missense	probably benign
R9664:Ap3d1	UTSW	10	80712805	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80709775	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CCTCCAGCTTCACATACTGG -3'
(R):5'- GCTTTAACCCTAACTGTAGCAAG -3'

Sequencing Primer
(F):5'- CATACTGGTCTGACATGGGCATAC -3'
(R):5'- AGCAAGGTTACAGTTAGCTCCTGC -3'

Posted On

2020-01-23