Incidental Mutation 'R8021:Tbc1d30'
ID 617380
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 121263820-121351278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121267543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 528 (M528T)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect probably benign
Transcript: ENSMUST00000064107
AA Change: M528T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: M528T

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121266824 utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121296845 missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121267414 missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121267051 missense probably benign
IGL01844:Tbc1d30 APN 10 121267179 missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121267620 missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121306230 splice site probably null
R2025:Tbc1d30 UTSW 10 121279146 missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121304407 missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121272168 missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121294712 missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121279158 missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121296786 missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121267216 missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121306838 missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121302110 missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121296787 missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121267574 missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121296845 missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121294725 missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121301992 missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121288965 missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121296805 missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121347156 nonsense probably null
R7958:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121306199 missense probably damaging 1.00
R8394:Tbc1d30 UTSW 10 121347108 nonsense probably null
R8472:Tbc1d30 UTSW 10 121351104 missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121267430 missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121351154 missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121296811 missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121275734 missense probably benign
R9282:Tbc1d30 UTSW 10 121306223 critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121267461 nonsense probably null
R9531:Tbc1d30 UTSW 10 121347200 missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121266981 missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121306169 missense possibly damaging 0.55
R9803:Tbc1d30 UTSW 10 121272075 missense probably damaging 1.00
Z1176:Tbc1d30 UTSW 10 121302113 missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121351064 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCCTAGATGACTCTTGGTCC -3'
(R):5'- CCCGGCACTAGGGTTTGATTTG -3'

Sequencing Primer
(F):5'- AGATGACTCTTGGTCCTCGGC -3'
(R):5'- CCAGCTTTTGGGGAAACGATTTG -3'
Posted On 2020-01-23