Incidental Mutation 'R8021:Tnk1'
ID617382
Institutional Source Beutler Lab
Gene Symbol Tnk1
Ensembl Gene ENSMUSG00000001583
Gene Nametyrosine kinase, non-receptor, 1
SynonymsTnk1a, Kos1, Tnk1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69851005-69858730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69854984 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000001626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000125571] [ENSMUST00000156507]
Predicted Effect probably benign
Transcript: ENSMUST00000001626
AA Change: S372P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583
AA Change: S372P

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019605
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108626
AA Change: S372P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583
AA Change: S372P

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108628
AA Change: S372P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583
AA Change: S372P

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108632
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108633
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125571
SMART Domains Protein: ENSMUSP00000118490
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 72 2e-6 BLAST
Pfam:Pkinase 116 268 3.3e-21 PFAM
Pfam:Pkinase_Tyr 116 268 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156507
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice either heterozygous or homozygous for a knock-out allele develop spontaneous tumors, including lymphomas and carcinomas, at high rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Tnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Tnk1 APN 11 69855905 unclassified probably benign
IGL02668:Tnk1 APN 11 69856923 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0389:Tnk1 UTSW 11 69855682 missense probably damaging 1.00
R0529:Tnk1 UTSW 11 69855164 missense probably damaging 1.00
R1396:Tnk1 UTSW 11 69853136 missense probably benign 0.01
R1436:Tnk1 UTSW 11 69852293 splice site probably benign
R1494:Tnk1 UTSW 11 69856546 missense possibly damaging 0.60
R1687:Tnk1 UTSW 11 69856473 missense possibly damaging 0.75
R1752:Tnk1 UTSW 11 69856706 missense possibly damaging 0.92
R1832:Tnk1 UTSW 11 69856928 missense probably damaging 0.99
R2109:Tnk1 UTSW 11 69855183 missense probably damaging 1.00
R2233:Tnk1 UTSW 11 69855191 splice site probably null
R2234:Tnk1 UTSW 11 69855191 splice site probably null
R2423:Tnk1 UTSW 11 69855761 missense probably damaging 0.98
R3018:Tnk1 UTSW 11 69854911 intron probably benign
R3689:Tnk1 UTSW 11 69855599 missense probably damaging 1.00
R4746:Tnk1 UTSW 11 69855166 missense probably damaging 1.00
R5653:Tnk1 UTSW 11 69853585 missense probably damaging 1.00
R6154:Tnk1 UTSW 11 69856954 missense probably damaging 1.00
R7384:Tnk1 UTSW 11 69851621 missense probably damaging 1.00
R7649:Tnk1 UTSW 11 69853577 splice site probably null
R7680:Tnk1 UTSW 11 69856745 missense possibly damaging 0.89
R8055:Tnk1 UTSW 11 69856501 missense probably benign 0.09
R8390:Tnk1 UTSW 11 69851869 missense possibly damaging 0.84
X0061:Tnk1 UTSW 11 69852272 missense probably damaging 1.00
Z1176:Tnk1 UTSW 11 69855523 missense possibly damaging 0.94
Z1177:Tnk1 UTSW 11 69855677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCTTTGCAGCCCTTGG -3'
(R):5'- GCGTGACACTCTGGGAAATG -3'

Sequencing Primer
(F):5'- CAGGGTTCTGCACTTCCTG -3'
(R):5'- CGTGACACTCTGGGAAATGTTTTC -3'
Posted On2020-01-23