Mutagenetix > Incidental Mutation

Incidental Mutation 'R8021:Pcnx'

617385

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

067460-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 81918819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 59 (R59*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]

AlphaFold

Q9QYC1

Predicted Effect

probably null
Transcript: ENSMUST00000021567
AA Change: R587*

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: R587*

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000221675
AA Change: R59*

Predicted Effect

probably null
Transcript: ENSMUST00000221721
AA Change: R587*

Predicted Effect

probably null
Transcript: ENSMUST00000222005
AA Change: R587*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	A	G	11: 107,025,927	I12V	unknown	Het
9130011E15Rik	C	T	19: 45,956,741		probably null	Het
A630010A05Rik	C	T	16: 14,589,246	T13I		Het
Acsm5	A	G	7: 119,542,393	E537G	possibly damaging	Het
Adam25	C	A	8: 40,754,759	A354E	probably damaging	Het
Adamts3	T	C	5: 89,683,184	K1004E	possibly damaging	Het
Ap3d1	C	A	10: 80,714,301	V699L	probably benign	Het
Arel1	T	G	12: 84,934,958	H216P	possibly damaging	Het
Armc12	T	A	17: 28,530,905	F8I	probably benign	Het
Ascc3	T	A	10: 50,731,648	M1416K	probably benign	Het
Catsperb	A	C	12: 101,588,063	N672T	probably benign	Het
Ccdc30	T	C	4: 119,352,679	H291R	probably benign	Het
Cd33	A	G	7: 43,528,838	V371A	unknown	Het
Cpt1b	A	T	15: 89,421,426	M362K	probably benign	Het
Dusp5	T	A	19: 53,529,498	S61T	probably benign	Het
Eogt	T	G	6: 97,134,330	D190A	probably damaging	Het
Fat3	T	A	9: 15,999,109	I1866F	probably damaging	Het
Fer1l4	T	A	2: 156,022,591	I1668F	probably damaging	Het
Foxn3	A	T	12: 99,388,902	M1K	probably null	Het
Frs3	T	A	17: 47,703,114	V244E	probably damaging	Het
Gm8765	A	G	13: 50,701,094	N256S	possibly damaging	Het
Grik1	C	T	16: 87,914,222	V832I		Het
Gtf2ird2	T	A	5: 134,203,334	V242E	probably benign	Het
Gtpbp2	C	T	17: 46,164,269	R97C	possibly damaging	Het
Habp2	T	A	19: 56,314,053	V263E	probably benign	Het
Iars2	T	A	1: 185,322,457	I337L	probably benign	Het
Ifi204	T	C	1: 173,759,353		probably benign	Het
Itih2	T	C	2: 10,105,652	T543A	probably benign	Het
Kdm2b	A	G	5: 122,932,919	S372P	probably damaging	Het
Kit	T	A	5: 75,615,491	V311E	possibly damaging	Het
Kmt2c	C	G	5: 25,287,119	V4230L	possibly damaging	Het
Lao1	T	C	4: 118,968,477	I498T	probably damaging	Het
Lrp1	G	T	10: 127,548,346	D3641E	possibly damaging	Het
Mapk8ip1	A	T	2: 92,386,415	S477T	possibly damaging	Het
Mast3	C	T	8: 70,788,252	G218S	probably benign	Het
Mical1	T	C	10: 41,482,724	V546A	probably damaging	Het
Nck2	T	C	1: 43,554,260	V209A	probably benign	Het
Ndufs4	A	G	13: 114,307,815		probably null	Het
Nek3	C	T	8: 22,157,190	V139M	probably damaging	Het
Olfr1417	T	C	19: 11,828,892	I45V	probably benign	Het
Olfr863-ps1	A	C	9: 19,942,079	Y120*	probably null	Het
Olfr877	T	A	9: 37,855,296	H159Q	probably damaging	Het
Olfr994	A	T	2: 85,430,652	M59K	probably damaging	Het
Otog	A	T	7: 46,267,342	N901I	probably damaging	Het
Pclo	A	C	5: 14,539,784	Q699H	unknown	Het
Pde12	A	T	14: 26,665,699	Y551*	probably null	Het
Pigg	A	G	5: 108,319,939	D268G	probably damaging	Het
Ppp1r21	A	G	17: 88,549,507	D130G	probably benign	Het
Psip1	T	C	4: 83,459,955	T435A	possibly damaging	Het
Rad54l2	T	C	9: 106,719,641	S189G	probably benign	Het
Rgs14	T	C	13: 55,383,756	C498R	probably damaging	Het
Ripply3	C	A	16: 94,328,510	A5E	probably benign	Het
Rps6ka4	T	C	19: 6,830,409	D676G	probably benign	Het
Rsbn1	T	C	3: 103,928,582	L312S	possibly damaging	Het
Secisbp2	T	A	13: 51,665,628	*415R	probably null	Het
Sephs1	T	A	2: 4,906,623	F336Y	probably benign	Het
Setdb2	A	T	14: 59,423,384	Y103*	probably null	Het
Slit2	T	A	5: 48,302,492	C1371*	probably null	Het
Stab2	C	T	10: 86,905,539	A1239T	possibly damaging	Het
Taf4b	T	A	18: 14,804,524	V218E	probably damaging	Het
Tars2	T	C	3: 95,747,514	N393S	probably benign	Het
Tbc1d30	A	G	10: 121,267,543	M528T	probably benign	Het
Tchp	A	G	5: 114,718,417	E363G	probably damaging	Het
Tec	T	A	5: 72,757,469	N568I	probably benign	Het
Ticam1	A	G	17: 56,270,089	S669P	unknown	Het
Tnk1	A	G	11: 69,854,984	S372P	probably benign	Het
Tnpo2	G	A	8: 85,055,206	A847T	probably damaging	Het
Tsc1	A	T	2: 28,686,889	I1068F	possibly damaging	Het
Ttc14	T	A	3: 33,809,121	Y559*	probably null	Het
Ttc41	C	A	10: 86,733,714	T652N	probably benign	Het
Tut1	T	A	19: 8,955,509	S69T	probably benign	Het
Uck1	T	C	2: 32,259,917	S40G	probably benign	Het
Vmn2r76	G	A	7: 86,225,750	T673I	probably damaging	Het
Vps13d	G	T	4: 145,148,675	P1760H		Het
Zbp1	T	C	2: 173,209,210	N289S	possibly damaging	Het
Zc3hav1l	C	A	6: 38,297,947		probably benign	Het
Zzef1	A	T	11: 72,823,416	D244V	probably damaging	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8202:Pcnx	UTSW	12	81895047	missense	probably benign	0.00
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
R8803:Pcnx	UTSW	12	81993151	missense	possibly damaging	0.85
R8820:Pcnx	UTSW	12	81973248	missense
R8828:Pcnx	UTSW	12	81995823	missense	probably damaging	1.00
R8946:Pcnx	UTSW	12	81971384	missense	probably damaging	0.96
R8964:Pcnx	UTSW	12	81993038	missense
R9152:Pcnx	UTSW	12	81975815	missense
R9256:Pcnx	UTSW	12	81973273	missense
R9287:Pcnx	UTSW	12	81995549	missense	probably benign	0.07
R9289:Pcnx	UTSW	12	81982079	missense
R9414:Pcnx	UTSW	12	81918204	missense	probably damaging	1.00
R9445:Pcnx	UTSW	12	81918207	missense	probably damaging	0.98
R9595:Pcnx	UTSW	12	81918914	missense
R9600:Pcnx	UTSW	12	81983661	missense
R9620:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- ATGAGTTTACTGTGCCTGGC -3'
(R):5'- TATTTGCCCTCGGGAGACTG -3'

Sequencing Primer
(F):5'- TGGCCACCGACTCCAGAG -3'
(R):5'- CTCGGGAGACTGGCAGGAATG -3'

Posted On

2020-01-23