Incidental Mutation 'R8021:Setdb2'
ID617394
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59423384 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 103 (Y103*)
Ref Sequence ENSEMBL: ENSMUSP00000106884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
Predicted Effect probably benign
Transcript: ENSMUST00000095775
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111253
AA Change: Y103*
Predicted Effect probably benign
Transcript: ENSMUST00000161459
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8513:Setdb2 UTSW 14 59402390 missense probably damaging 1.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTTCGCCTCATATTTGC -3'
(R):5'- CCGTTTGGGCAGAATTTCTAGTC -3'

Sequencing Primer
(F):5'- TGTAGACACTGAGCTGACACTG -3'
(R):5'- GGGCAGAATTTCTAGTCAGTGAG -3'
Posted On2020-01-23