Incidental Mutation 'R8021:Ripply3'
ID617398
Institutional Source Beutler Lab
Gene Symbol Ripply3
Ensembl Gene ENSMUSG00000022941
Gene Nameripply transcriptional repressor 3
SynonymsDscr6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94328420-94336935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94328510 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 5 (A5E)
Ref Sequence ENSEMBL: ENSMUSP00000023660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023660]
Predicted Effect probably benign
Transcript: ENSMUST00000023660
AA Change: A5E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023660
Gene: ENSMUSG00000022941
AA Change: A5E

DomainStartEndE-ValueType
Pfam:Ripply 39 127 6.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show complete neonatal lethality, abnormal development of the pharyngeal apparatus and its derivatives including ectopic formation of the thymus and the parathyroid gland, and cardiovascular defects such as deletion of the aortic arch and misshapen great vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Ripply3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Ripply3 APN 16 94328543 missense possibly damaging 0.89
R0271:Ripply3 UTSW 16 94335757 missense possibly damaging 0.82
R4568:Ripply3 UTSW 16 94335829 missense probably damaging 1.00
R7400:Ripply3 UTSW 16 94335900 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCATCTCGGAGGCCCTGTAG -3'
(R):5'- GTCCCTGCACTTCAGACAGG -3'

Sequencing Primer
(F):5'- TGTAGGCCGTCTGTCCC -3'
(R):5'- CCTGCACTTCAGACAGGAGTTTG -3'
Posted On2020-01-23