Mutagenetix > Incidental Mutation

Incidental Mutation 'R8021:Taf4b'

617404

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

067460-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

R8021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14804524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 218 (V218E)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: V218E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: V218E

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	A	G	11: 107,025,927	I12V	unknown	Het
9130011E15Rik	C	T	19: 45,956,741		probably null	Het
A630010A05Rik	C	T	16: 14,589,246	T13I		Het
Acsm5	A	G	7: 119,542,393	E537G	possibly damaging	Het
Adam25	C	A	8: 40,754,759	A354E	probably damaging	Het
Adamts3	T	C	5: 89,683,184	K1004E	possibly damaging	Het
Ap3d1	C	A	10: 80,714,301	V699L	probably benign	Het
Arel1	T	G	12: 84,934,958	H216P	possibly damaging	Het
Armc12	T	A	17: 28,530,905	F8I	probably benign	Het
Ascc3	T	A	10: 50,731,648	M1416K	probably benign	Het
Catsperb	A	C	12: 101,588,063	N672T	probably benign	Het
Ccdc30	T	C	4: 119,352,679	H291R	probably benign	Het
Cd33	A	G	7: 43,528,838	V371A	unknown	Het
Cpt1b	A	T	15: 89,421,426	M362K	probably benign	Het
Dusp5	T	A	19: 53,529,498	S61T	probably benign	Het
Eogt	T	G	6: 97,134,330	D190A	probably damaging	Het
Fat3	T	A	9: 15,999,109	I1866F	probably damaging	Het
Fer1l4	T	A	2: 156,022,591	I1668F	probably damaging	Het
Foxn3	A	T	12: 99,388,902	M1K	probably null	Het
Frs3	T	A	17: 47,703,114	V244E	probably damaging	Het
Gm8765	A	G	13: 50,701,094	N256S	possibly damaging	Het
Grik1	C	T	16: 87,914,222	V832I		Het
Gtf2ird2	T	A	5: 134,203,334	V242E	probably benign	Het
Gtpbp2	C	T	17: 46,164,269	R97C	possibly damaging	Het
Habp2	T	A	19: 56,314,053	V263E	probably benign	Het
Iars2	T	A	1: 185,322,457	I337L	probably benign	Het
Ifi204	T	C	1: 173,759,353		probably benign	Het
Itih2	T	C	2: 10,105,652	T543A	probably benign	Het
Kdm2b	A	G	5: 122,932,919	S372P	probably damaging	Het
Kit	T	A	5: 75,615,491	V311E	possibly damaging	Het
Kmt2c	C	G	5: 25,287,119	V4230L	possibly damaging	Het
Lao1	T	C	4: 118,968,477	I498T	probably damaging	Het
Lrp1	G	T	10: 127,548,346	D3641E	possibly damaging	Het
Mapk8ip1	A	T	2: 92,386,415	S477T	possibly damaging	Het
Mast3	C	T	8: 70,788,252	G218S	probably benign	Het
Mical1	T	C	10: 41,482,724	V546A	probably damaging	Het
Nck2	T	C	1: 43,554,260	V209A	probably benign	Het
Ndufs4	A	G	13: 114,307,815		probably null	Het
Nek3	C	T	8: 22,157,190	V139M	probably damaging	Het
Olfr1417	T	C	19: 11,828,892	I45V	probably benign	Het
Olfr863-ps1	A	C	9: 19,942,079	Y120*	probably null	Het
Olfr877	T	A	9: 37,855,296	H159Q	probably damaging	Het
Olfr994	A	T	2: 85,430,652	M59K	probably damaging	Het
Otog	A	T	7: 46,267,342	N901I	probably damaging	Het
Pclo	A	C	5: 14,539,784	Q699H	unknown	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pde12	A	T	14: 26,665,699	Y551*	probably null	Het
Pigg	A	G	5: 108,319,939	D268G	probably damaging	Het
Ppp1r21	A	G	17: 88,549,507	D130G	probably benign	Het
Psip1	T	C	4: 83,459,955	T435A	possibly damaging	Het
Rad54l2	T	C	9: 106,719,641	S189G	probably benign	Het
Rgs14	T	C	13: 55,383,756	C498R	probably damaging	Het
Ripply3	C	A	16: 94,328,510	A5E	probably benign	Het
Rps6ka4	T	C	19: 6,830,409	D676G	probably benign	Het
Rsbn1	T	C	3: 103,928,582	L312S	possibly damaging	Het
Secisbp2	T	A	13: 51,665,628	*415R	probably null	Het
Sephs1	T	A	2: 4,906,623	F336Y	probably benign	Het
Setdb2	A	T	14: 59,423,384	Y103*	probably null	Het
Slit2	T	A	5: 48,302,492	C1371*	probably null	Het
Stab2	C	T	10: 86,905,539	A1239T	possibly damaging	Het
Tars2	T	C	3: 95,747,514	N393S	probably benign	Het
Tbc1d30	A	G	10: 121,267,543	M528T	probably benign	Het
Tchp	A	G	5: 114,718,417	E363G	probably damaging	Het
Tec	T	A	5: 72,757,469	N568I	probably benign	Het
Ticam1	A	G	17: 56,270,089	S669P	unknown	Het
Tnk1	A	G	11: 69,854,984	S372P	probably benign	Het
Tnpo2	G	A	8: 85,055,206	A847T	probably damaging	Het
Tsc1	A	T	2: 28,686,889	I1068F	possibly damaging	Het
Ttc14	T	A	3: 33,809,121	Y559*	probably null	Het
Ttc41	C	A	10: 86,733,714	T652N	probably benign	Het
Tut1	T	A	19: 8,955,509	S69T	probably benign	Het
Uck1	T	C	2: 32,259,917	S40G	probably benign	Het
Vmn2r76	G	A	7: 86,225,750	T673I	probably damaging	Het
Vps13d	G	T	4: 145,148,675	P1760H		Het
Zbp1	T	C	2: 173,209,210	N289S	possibly damaging	Het
Zc3hav1l	C	A	6: 38,297,947		probably benign	Het
Zzef1	A	T	11: 72,823,416	D244V	probably damaging	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9630:Taf4b	UTSW	18	14797020	missense	probably damaging	0.96
R9686:Taf4b	UTSW	18	14799158	missense	possibly damaging	0.87
R9801:Taf4b	UTSW	18	14799178	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TACTTGAAAGCAGAGATGCCAG -3'
(R):5'- AGACTGTGATCCACTACATGCTAG -3'

Sequencing Primer
(F):5'- GCCAGAATTCATTTGGAGCC -3'
(R):5'- TTCACATTTTCTAGCACTGTCTG -3'

Posted On

2020-01-23