Incidental Mutation 'R8021:Tut1'
ID 617406
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Name terminal uridylyl transferase 1, U6 snRNA-specific
Synonyms Rbm21, 2700038E08Rik, PAPD2, TUTase6, Tent1
MMRRC Submission 067460-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.541) question?
Stock # R8021 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8931211-8943574 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8932873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 69 (S69T)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096239] [ENSMUST00000096240]
AlphaFold Q8R3F9
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: S69T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: S69T

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 106,916,753 (GRCm39) I12V unknown Het
A630010A05Rik C T 16: 14,407,110 (GRCm39) T13I Het
Acsm5 A G 7: 119,141,616 (GRCm39) E537G possibly damaging Het
Adam25 C A 8: 41,207,796 (GRCm39) A354E probably damaging Het
Adamts3 T C 5: 89,831,043 (GRCm39) K1004E possibly damaging Het
Ap3d1 C A 10: 80,550,135 (GRCm39) V699L probably benign Het
Arel1 T G 12: 84,981,732 (GRCm39) H216P possibly damaging Het
Armc12 T A 17: 28,749,879 (GRCm39) F8I probably benign Het
Armh3 C T 19: 45,945,180 (GRCm39) probably null Het
Ascc3 T A 10: 50,607,744 (GRCm39) M1416K probably benign Het
Catsperb A C 12: 101,554,322 (GRCm39) N672T probably benign Het
Ccdc30 T C 4: 119,209,876 (GRCm39) H291R probably benign Het
Cd33 A G 7: 43,178,262 (GRCm39) V371A unknown Het
Cpt1b A T 15: 89,305,629 (GRCm39) M362K probably benign Het
Dusp5 T A 19: 53,517,929 (GRCm39) S61T probably benign Het
Eogt T G 6: 97,111,291 (GRCm39) D190A probably damaging Het
Fat3 T A 9: 15,910,405 (GRCm39) I1866F probably damaging Het
Fer1l4 T A 2: 155,864,511 (GRCm39) I1668F probably damaging Het
Foxn3 A T 12: 99,355,161 (GRCm39) M1K probably null Het
Frs3 T A 17: 48,014,039 (GRCm39) V244E probably damaging Het
Grik1 C T 16: 87,711,110 (GRCm39) V832I Het
Gtf2ird2 T A 5: 134,232,175 (GRCm39) V242E probably benign Het
Gtpbp2 C T 17: 46,475,195 (GRCm39) R97C possibly damaging Het
Habp2 T A 19: 56,302,485 (GRCm39) V263E probably benign Het
Iars2 T A 1: 185,054,654 (GRCm39) I337L probably benign Het
Ifi204 T C 1: 173,586,919 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,463 (GRCm39) T543A probably benign Het
Kdm2b A G 5: 123,070,982 (GRCm39) S372P probably damaging Het
Kit T A 5: 75,776,151 (GRCm39) V311E possibly damaging Het
Kmt2c C G 5: 25,492,117 (GRCm39) V4230L possibly damaging Het
Lao1 T C 4: 118,825,674 (GRCm39) I498T probably damaging Het
Lrp1 G T 10: 127,384,215 (GRCm39) D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,216,760 (GRCm39) S477T possibly damaging Het
Mast3 C T 8: 71,240,896 (GRCm39) G218S probably benign Het
Mical1 T C 10: 41,358,720 (GRCm39) V546A probably damaging Het
Nck2 T C 1: 43,593,420 (GRCm39) V209A probably benign Het
Ndufs4 A G 13: 114,444,351 (GRCm39) probably null Het
Nek3 C T 8: 22,647,206 (GRCm39) V139M probably damaging Het
Or10v5 T C 19: 11,806,256 (GRCm39) I45V probably benign Het
Or5ak24 A T 2: 85,260,996 (GRCm39) M59K probably damaging Het
Or7e171-ps1 A C 9: 19,853,375 (GRCm39) Y120* probably null Het
Or8b9 T A 9: 37,766,592 (GRCm39) H159Q probably damaging Het
Otog A T 7: 45,916,766 (GRCm39) N901I probably damaging Het
Pclo A C 5: 14,589,798 (GRCm39) Q699H unknown Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde12 A T 14: 26,386,854 (GRCm39) Y551* probably null Het
Pigg A G 5: 108,467,805 (GRCm39) D268G probably damaging Het
Ppp1r21 A G 17: 88,856,935 (GRCm39) D130G probably benign Het
Psip1 T C 4: 83,378,192 (GRCm39) T435A possibly damaging Het
Rad54l2 T C 9: 106,596,840 (GRCm39) S189G probably benign Het
Rgs14 T C 13: 55,531,569 (GRCm39) C498R probably damaging Het
Ripply3 C A 16: 94,129,369 (GRCm39) A5E probably benign Het
Rps6ka4 T C 19: 6,807,777 (GRCm39) D676G probably benign Het
Rsbn1 T C 3: 103,835,898 (GRCm39) L312S possibly damaging Het
Secisbp2 T A 13: 51,819,664 (GRCm39) *415R probably null Het
Sephs1 T A 2: 4,911,434 (GRCm39) F336Y probably benign Het
Setdb2 A T 14: 59,660,833 (GRCm39) Y103* probably null Het
Slit2 T A 5: 48,459,834 (GRCm39) C1371* probably null Het
Spata31e4 A G 13: 50,855,130 (GRCm39) N256S possibly damaging Het
Stab2 C T 10: 86,741,403 (GRCm39) A1239T possibly damaging Het
Taf4b T A 18: 14,937,581 (GRCm39) V218E probably damaging Het
Tars2 T C 3: 95,654,826 (GRCm39) N393S probably benign Het
Tbc1d30 A G 10: 121,103,448 (GRCm39) M528T probably benign Het
Tchp A G 5: 114,856,478 (GRCm39) E363G probably damaging Het
Tec T A 5: 72,914,812 (GRCm39) N568I probably benign Het
Ticam1 A G 17: 56,577,089 (GRCm39) S669P unknown Het
Tnk1 A G 11: 69,745,810 (GRCm39) S372P probably benign Het
Tnpo2 G A 8: 85,781,835 (GRCm39) A847T probably damaging Het
Tsc1 A T 2: 28,576,901 (GRCm39) I1068F possibly damaging Het
Ttc14 T A 3: 33,863,270 (GRCm39) Y559* probably null Het
Ttc41 C A 10: 86,569,578 (GRCm39) T652N probably benign Het
Uck1 T C 2: 32,149,929 (GRCm39) S40G probably benign Het
Vmn2r76 G A 7: 85,874,958 (GRCm39) T673I probably damaging Het
Vps13d G T 4: 144,875,245 (GRCm39) P1760H Het
Zbp1 T C 2: 173,051,003 (GRCm39) N289S possibly damaging Het
Zc3hav1l C A 6: 38,274,882 (GRCm39) probably benign Het
Zzef1 A T 11: 72,714,242 (GRCm39) D244V probably damaging Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8,936,460 (GRCm39) missense probably damaging 1.00
IGL01934:Tut1 APN 19 8,931,355 (GRCm39) missense probably damaging 1.00
IGL01980:Tut1 APN 19 8,931,364 (GRCm39) missense probably damaging 1.00
IGL02115:Tut1 APN 19 8,942,676 (GRCm39) missense probably damaging 1.00
IGL02375:Tut1 APN 19 8,941,403 (GRCm39) missense probably damaging 1.00
IGL02683:Tut1 APN 19 8,942,622 (GRCm39) missense probably benign 0.31
IGL02899:Tut1 APN 19 8,939,751 (GRCm39) missense probably damaging 1.00
IGL02953:Tut1 APN 19 8,940,056 (GRCm39) missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8,936,626 (GRCm39) missense probably benign 0.00
R0014:Tut1 UTSW 19 8,939,811 (GRCm39) missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8,939,811 (GRCm39) missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8,940,123 (GRCm39) missense probably benign 0.03
R0091:Tut1 UTSW 19 8,942,800 (GRCm39) missense probably damaging 0.97
R0173:Tut1 UTSW 19 8,942,847 (GRCm39) nonsense probably null
R0362:Tut1 UTSW 19 8,932,891 (GRCm39) missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8,940,137 (GRCm39) missense probably damaging 0.98
R0386:Tut1 UTSW 19 8,932,919 (GRCm39) missense probably benign 0.00
R1022:Tut1 UTSW 19 8,936,719 (GRCm39) missense probably benign
R1024:Tut1 UTSW 19 8,936,719 (GRCm39) missense probably benign
R1539:Tut1 UTSW 19 8,942,850 (GRCm39) missense probably benign 0.02
R1921:Tut1 UTSW 19 8,943,466 (GRCm39) missense probably benign
R1958:Tut1 UTSW 19 8,936,677 (GRCm39) missense probably damaging 1.00
R2508:Tut1 UTSW 19 8,932,931 (GRCm39) missense probably damaging 0.98
R4757:Tut1 UTSW 19 8,936,672 (GRCm39) missense possibly damaging 0.83
R5104:Tut1 UTSW 19 8,936,698 (GRCm39) missense probably benign 0.03
R5185:Tut1 UTSW 19 8,932,814 (GRCm39) missense probably benign 0.07
R6999:Tut1 UTSW 19 8,943,382 (GRCm39) missense probably damaging 1.00
R7084:Tut1 UTSW 19 8,942,778 (GRCm39) missense probably benign
R7091:Tut1 UTSW 19 8,943,175 (GRCm39) missense probably benign
R7313:Tut1 UTSW 19 8,941,413 (GRCm39) missense probably benign 0.00
R7361:Tut1 UTSW 19 8,942,698 (GRCm39) missense probably damaging 1.00
R7730:Tut1 UTSW 19 8,941,740 (GRCm39) critical splice donor site probably null
R7731:Tut1 UTSW 19 8,936,626 (GRCm39) missense probably benign 0.01
R8355:Tut1 UTSW 19 8,936,626 (GRCm39) missense probably benign
R8455:Tut1 UTSW 19 8,936,626 (GRCm39) missense probably benign
R8989:Tut1 UTSW 19 8,937,116 (GRCm39) missense possibly damaging 0.89
R9581:Tut1 UTSW 19 8,941,981 (GRCm39) missense probably benign 0.07
Z1177:Tut1 UTSW 19 8,942,596 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCCATATGTACAGAGCAGAGC -3'
(R):5'- TGTCAGAAGCTCACCAACTG -3'

Sequencing Primer
(F):5'- TCCATATGTACAGAGCAGAGCAAGAG -3'
(R):5'- CACCAACTGAGCTACTTAATGTTCTG -3'
Posted On 2020-01-23