Mutagenetix > Incidental Mutation

Incidental Mutation 'R8021:Dusp5'

617409

Institutional Source

Beutler Lab

Gene Symbol

Dusp5

Ensembl Gene

ENSMUSG00000034765

Gene Name

dual specificity phosphatase 5

Synonyms

LOC240672

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8021 (G1)

Quality Score

159.009

Status

Not validated

Chromosome

Chromosomal Location

53529109-53542431 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53529498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 61 (S61T)

Ref Sequence

ENSEMBL: ENSMUSP00000047900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038287]

AlphaFold

Q1HL35

Predicted Effect

probably benign
Transcript: ENSMUST00000038287
AA Change: S61T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000047900
Gene: ENSMUSG00000034765
AA Change: S61T

Domain	Start	End	E-Value	Type
RHOD	9	138	1.88e-13	SMART
DSPc	178	316	4.48e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased proliferation and apoptosis and altered metabolic profiles in T cells. Mice homozygous for other null alleles exhibit altered eosinophilic response to parasicitc infection and increased susceptibility to induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	A	G	11: 107,025,927	I12V	unknown	Het
9130011E15Rik	C	T	19: 45,956,741		probably null	Het
A630010A05Rik	C	T	16: 14,589,246	T13I		Het
Acsm5	A	G	7: 119,542,393	E537G	possibly damaging	Het
Adam25	C	A	8: 40,754,759	A354E	probably damaging	Het
Adamts3	T	C	5: 89,683,184	K1004E	possibly damaging	Het
Ap3d1	C	A	10: 80,714,301	V699L	probably benign	Het
Arel1	T	G	12: 84,934,958	H216P	possibly damaging	Het
Armc12	T	A	17: 28,530,905	F8I	probably benign	Het
Ascc3	T	A	10: 50,731,648	M1416K	probably benign	Het
Catsperb	A	C	12: 101,588,063	N672T	probably benign	Het
Ccdc30	T	C	4: 119,352,679	H291R	probably benign	Het
Cd33	A	G	7: 43,528,838	V371A	unknown	Het
Cpt1b	A	T	15: 89,421,426	M362K	probably benign	Het
Eogt	T	G	6: 97,134,330	D190A	probably damaging	Het
Fat3	T	A	9: 15,999,109	I1866F	probably damaging	Het
Fer1l4	T	A	2: 156,022,591	I1668F	probably damaging	Het
Foxn3	A	T	12: 99,388,902	M1K	probably null	Het
Frs3	T	A	17: 47,703,114	V244E	probably damaging	Het
Gm8765	A	G	13: 50,701,094	N256S	possibly damaging	Het
Grik1	C	T	16: 87,914,222	V832I		Het
Gtf2ird2	T	A	5: 134,203,334	V242E	probably benign	Het
Gtpbp2	C	T	17: 46,164,269	R97C	possibly damaging	Het
Habp2	T	A	19: 56,314,053	V263E	probably benign	Het
Iars2	T	A	1: 185,322,457	I337L	probably benign	Het
Ifi204	T	C	1: 173,759,353		probably benign	Het
Itih2	T	C	2: 10,105,652	T543A	probably benign	Het
Kdm2b	A	G	5: 122,932,919	S372P	probably damaging	Het
Kit	T	A	5: 75,615,491	V311E	possibly damaging	Het
Kmt2c	C	G	5: 25,287,119	V4230L	possibly damaging	Het
Lao1	T	C	4: 118,968,477	I498T	probably damaging	Het
Lrp1	G	T	10: 127,548,346	D3641E	possibly damaging	Het
Mapk8ip1	A	T	2: 92,386,415	S477T	possibly damaging	Het
Mast3	C	T	8: 70,788,252	G218S	probably benign	Het
Mical1	T	C	10: 41,482,724	V546A	probably damaging	Het
Nck2	T	C	1: 43,554,260	V209A	probably benign	Het
Ndufs4	A	G	13: 114,307,815		probably null	Het
Nek3	C	T	8: 22,157,190	V139M	probably damaging	Het
Olfr1417	T	C	19: 11,828,892	I45V	probably benign	Het
Olfr863-ps1	A	C	9: 19,942,079	Y120*	probably null	Het
Olfr877	T	A	9: 37,855,296	H159Q	probably damaging	Het
Olfr994	A	T	2: 85,430,652	M59K	probably damaging	Het
Otog	A	T	7: 46,267,342	N901I	probably damaging	Het
Pclo	A	C	5: 14,539,784	Q699H	unknown	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pde12	A	T	14: 26,665,699	Y551*	probably null	Het
Pigg	A	G	5: 108,319,939	D268G	probably damaging	Het
Ppp1r21	A	G	17: 88,549,507	D130G	probably benign	Het
Psip1	T	C	4: 83,459,955	T435A	possibly damaging	Het
Rad54l2	T	C	9: 106,719,641	S189G	probably benign	Het
Rgs14	T	C	13: 55,383,756	C498R	probably damaging	Het
Ripply3	C	A	16: 94,328,510	A5E	probably benign	Het
Rps6ka4	T	C	19: 6,830,409	D676G	probably benign	Het
Rsbn1	T	C	3: 103,928,582	L312S	possibly damaging	Het
Secisbp2	T	A	13: 51,665,628	*415R	probably null	Het
Sephs1	T	A	2: 4,906,623	F336Y	probably benign	Het
Setdb2	A	T	14: 59,423,384	Y103*	probably null	Het
Slit2	T	A	5: 48,302,492	C1371*	probably null	Het
Stab2	C	T	10: 86,905,539	A1239T	possibly damaging	Het
Taf4b	T	A	18: 14,804,524	V218E	probably damaging	Het
Tars2	T	C	3: 95,747,514	N393S	probably benign	Het
Tbc1d30	A	G	10: 121,267,543	M528T	probably benign	Het
Tchp	A	G	5: 114,718,417	E363G	probably damaging	Het
Tec	T	A	5: 72,757,469	N568I	probably benign	Het
Ticam1	A	G	17: 56,270,089	S669P	unknown	Het
Tnk1	A	G	11: 69,854,984	S372P	probably benign	Het
Tnpo2	G	A	8: 85,055,206	A847T	probably damaging	Het
Tsc1	A	T	2: 28,686,889	I1068F	possibly damaging	Het
Ttc14	T	A	3: 33,809,121	Y559*	probably null	Het
Ttc41	C	A	10: 86,733,714	T652N	probably benign	Het
Tut1	T	A	19: 8,955,509	S69T	probably benign	Het
Uck1	T	C	2: 32,259,917	S40G	probably benign	Het
Vmn2r76	G	A	7: 86,225,750	T673I	probably damaging	Het
Vps13d	G	T	4: 145,148,675	P1760H		Het
Zbp1	T	C	2: 173,209,210	N289S	possibly damaging	Het
Zc3hav1l	C	A	6: 38,297,947		probably benign	Het
Zzef1	A	T	11: 72,823,416	D244V	probably damaging	Het

Other mutations in Dusp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01949:Dusp5	APN	19	53537473	missense	probably damaging	1.00
IGL02017:Dusp5	APN	19	53537506	missense	probably damaging	1.00
R4523:Dusp5	UTSW	19	53537601	missense	probably damaging	1.00
R5350:Dusp5	UTSW	19	53541234	missense	probably damaging	1.00
R7941:Dusp5	UTSW	19	53537533	missense	probably benign
R8142:Dusp5	UTSW	19	53537481	missense	probably damaging	1.00
R8155:Dusp5	UTSW	19	53541106	nonsense	probably null
R8336:Dusp5	UTSW	19	53540975	missense	probably damaging	1.00
R8353:Dusp5	UTSW	19	53529682	missense	possibly damaging	0.48
R8881:Dusp5	UTSW	19	53541314	missense	probably benign	0.05
R9640:Dusp5	UTSW	19	53537620	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACATAAAACGCTGCGCTG -3'
(R):5'- TTTAAGGAAGTAGACCCGCGG -3'

Sequencing Primer
(F):5'- CATGAAGGTCACGTCGCTC -3'
(R):5'- TACCCTGGTCCAGCACGAC -3'

Posted On

2020-01-23