Incidental Mutation 'R8021:Habp2'
ID617410
Institutional Source Beutler Lab
Gene Symbol Habp2
Ensembl Gene ENSMUSG00000025075
Gene Namehyaluronic acid binding protein 2
SynonymsFSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location56287137-56320822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56314053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 263 (V263E)
Ref Sequence ENSEMBL: ENSMUSP00000093641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078284] [ENSMUST00000095948] [ENSMUST00000163502] [ENSMUST00000165522] [ENSMUST00000166049] [ENSMUST00000171341]
Predicted Effect probably benign
Transcript: ENSMUST00000078284
AA Change: V300E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077402
Gene: ENSMUSG00000025075
AA Change: V300E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 307 544 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095948
AA Change: V263E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093641
Gene: ENSMUSG00000025075
AA Change: V263E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 33 66 4.66e-6 SMART
EGF 71 105 3.97e0 SMART
EGF 110 145 2.26e-4 SMART
KR 149 235 2.72e-39 SMART
Tryp_SPc 270 507 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163502
AA Change: V69E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128964
Gene: ENSMUSG00000025075
AA Change: V69E

DomainStartEndE-ValueType
KR 1 41 5.87e-6 SMART
Tryp_SPc 76 220 5.6e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165522
AA Change: V33E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130809
Gene: ENSMUSG00000025075
AA Change: V33E

DomainStartEndE-ValueType
Pfam:Trypsin 41 106 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166049
AA Change: V295E

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132444
Gene: ENSMUSG00000025075
AA Change: V295E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 302 539 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171341
SMART Domains Protein: ENSMUSP00000126235
Gene: ENSMUSG00000025075

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by hepatocytes and proteolytically processed to generate heavy and light chains that form the mature heterodimer. Further autoproteolysis leads to smaller, inactive peptides. This extracellular protease binds hyaluronic acid and may play a role in the coagulation and fibrinolysis systems. Mutations in this gene are associated with nonmedullary thyroid cancer and susceptibility to venous thromboembolism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased lethality but increased liver fibrosis, inflammation and injury following bile duct ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Habp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Habp2 APN 19 56317832 missense probably damaging 1.00
IGL01113:Habp2 APN 19 56310116 missense probably benign 0.13
IGL01737:Habp2 APN 19 56316307 missense probably benign 0.00
IGL02174:Habp2 APN 19 56311737 missense probably damaging 0.96
IGL02250:Habp2 APN 19 56308929 missense probably benign 0.00
IGL02706:Habp2 APN 19 56310138 critical splice donor site probably null
IGL02953:Habp2 APN 19 56314232 critical splice donor site probably null
IGL02986:Habp2 APN 19 56311192 missense probably benign 0.25
IGL03010:Habp2 APN 19 56311223 critical splice donor site probably null
R0415:Habp2 UTSW 19 56317717 unclassified probably benign
R0483:Habp2 UTSW 19 56316432 unclassified probably benign
R0627:Habp2 UTSW 19 56314046 missense probably damaging 1.00
R1188:Habp2 UTSW 19 56311722 missense probably benign 0.39
R1880:Habp2 UTSW 19 56317828 missense possibly damaging 0.83
R2214:Habp2 UTSW 19 56317817 missense possibly damaging 0.88
R2473:Habp2 UTSW 19 56288032 missense possibly damaging 0.92
R2869:Habp2 UTSW 19 56287991 unclassified probably benign
R2871:Habp2 UTSW 19 56287991 unclassified probably benign
R3917:Habp2 UTSW 19 56311179 missense probably damaging 1.00
R3969:Habp2 UTSW 19 56311701 missense probably damaging 1.00
R4014:Habp2 UTSW 19 56319622 missense probably benign 0.04
R4853:Habp2 UTSW 19 56311191 splice site probably null
R5835:Habp2 UTSW 19 56306786 missense probably benign 0.16
R6270:Habp2 UTSW 19 56306863 missense possibly damaging 0.93
R6390:Habp2 UTSW 19 56306823 missense possibly damaging 0.63
R7110:Habp2 UTSW 19 56311164 nonsense probably null
R7268:Habp2 UTSW 19 56314086 missense probably damaging 1.00
R7456:Habp2 UTSW 19 56319525 missense probably damaging 1.00
R7583:Habp2 UTSW 19 56311804 missense probably benign 0.03
R8383:Habp2 UTSW 19 56316336 missense probably damaging 1.00
Z1176:Habp2 UTSW 19 56317760 missense probably damaging 1.00
Z1177:Habp2 UTSW 19 56319553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAACAACATATCGAAGGTGTGCC -3'
(R):5'- TCCCCATGGATACCTACTCG -3'

Sequencing Primer
(F):5'- ACATATCGAAGGTGTGCCATCTC -3'
(R):5'- TACCTACTCGGTACAGTGGG -3'
Posted On2020-01-23