Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Cdh20'

617413

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

067461-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109988838 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 247 (S247T)

Ref Sequence

ENSEMBL: ENSMUSP00000027542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]

AlphaFold

Q9Z0M3

Predicted Effect

probably benign
Transcript: ENSMUST00000027542
AA Change: S247T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: S247T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	633	778	6e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112701
AA Change: S247T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: S247T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131464

SMART Domains

Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
PDB:1ZVN\|B	49	70	1e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172005
AA Change: S247T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: S247T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,361,915 (GRCm39)	T1386S	probably benign	Het
AI661453	T	G	17: 47,777,161 (GRCm39)	S296A	unknown	Het
Ambp	G	T	4: 63,062,434 (GRCm39)	N268K	probably damaging	Het
Ankrd11	T	C	8: 123,614,332 (GRCm39)	K2503E	probably damaging	Het
Ap1g1	C	A	8: 110,559,367 (GRCm39)	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,455,904 (GRCm39)		probably null	Het
Aspa	A	C	11: 73,213,032 (GRCm39)	N103K	probably benign	Het
Bend7	G	A	2: 4,757,590 (GRCm39)	V211I	probably benign	Het
Bsn	A	G	9: 107,991,603 (GRCm39)	M1383T	probably benign	Het
Cad	G	T	5: 31,226,150 (GRCm39)	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,723,358 (GRCm39)	L856S	probably damaging	Het
Ces1b	A	G	8: 93,795,943 (GRCm39)		probably null	Het
Chd7	T	A	4: 8,751,605 (GRCm39)	V34E	unknown	Het
Clca3a2	A	T	3: 144,511,527 (GRCm39)	F623I	probably damaging	Het
Cope	T	G	8: 70,765,453 (GRCm39)	M217R	probably benign	Het
Crim1	T	A	17: 78,622,984 (GRCm39)	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,760,486 (GRCm39)	I644N	probably damaging	Het
Cry1	G	A	10: 84,982,266 (GRCm39)	A360V	probably damaging	Het
Ctcfl	A	T	2: 172,960,559 (GRCm39)	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,500,315 (GRCm39)	Q475*	probably null	Het
Cyp39a1	T	C	17: 44,057,468 (GRCm39)	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,914,478 (GRCm39)	Q484L	probably benign	Het
Dnah1	A	G	14: 30,986,971 (GRCm39)	F3607S	probably damaging	Het
Dnali1	T	A	4: 124,959,323 (GRCm39)	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,081,052 (GRCm39)	I313V	probably benign	Het
Ehhadh	C	A	16: 21,596,570 (GRCm39)	A53S	probably benign	Het
Epcam	T	C	17: 87,953,736 (GRCm39)	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062 (GRCm39)	I155V	possibly damaging	Het
Fgd6	A	T	10: 93,880,206 (GRCm39)	K353N	possibly damaging	Het
Glce	A	T	9: 61,967,873 (GRCm39)	M426K	probably benign	Het
Glmp	A	T	3: 88,233,827 (GRCm39)	N228I	probably damaging	Het
Gm4787	C	A	12: 81,424,494 (GRCm39)	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,058,800 (GRCm39)	H273L	probably benign	Het
Gzmg	T	A	14: 56,394,903 (GRCm39)	T122S	probably benign	Het
Hace1	T	C	10: 45,577,066 (GRCm39)	V820A	probably damaging	Het
Igf2r	T	A	17: 12,937,682 (GRCm39)	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,366,189 (GRCm39)	M20V	probably benign	Het
Kcnn3	T	G	3: 89,517,010 (GRCm39)	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,122,446 (GRCm39)	F94Y	unknown	Het
Kmt2c	C	T	5: 25,486,678 (GRCm39)	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,639,754 (GRCm39)	E740G	probably benign	Het
Lmod3	T	C	6: 97,225,260 (GRCm39)	D187G	probably benign	Het
Lsm3	C	T	6: 91,496,543 (GRCm39)	H49Y	probably benign	Het
Lypd10	T	A	7: 24,413,599 (GRCm39)	I205N	possibly damaging	Het
Magi1	T	C	6: 93,674,346 (GRCm39)	S962G	probably damaging	Het
Man2b1	G	A	8: 85,822,242 (GRCm39)	R782Q	probably damaging	Het
Mical2	A	T	7: 111,902,974 (GRCm39)	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,299,431 (GRCm39)	Q1256*	probably null	Het
Ncam1	G	T	9: 49,476,192 (GRCm39)	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,839,136 (GRCm39)	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,515,113 (GRCm39)	N28D	probably benign	Het
Nprl2	A	C	9: 107,420,260 (GRCm39)	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510 (GRCm39)	I88N	probably damaging	Het
Oas3	A	G	5: 120,895,031 (GRCm39)	I986T	possibly damaging	Het
Or6c76	A	T	10: 129,612,654 (GRCm39)	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,247,412 (GRCm39)	Y187F	possibly damaging	Het
Pgc	A	G	17: 48,039,701 (GRCm39)	T32A	probably benign	Het
Ranbp2	A	C	10: 58,321,683 (GRCm39)	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,565 (GRCm39)	R46G		Het
Rrbp1	C	A	2: 143,798,712 (GRCm39)	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,904,050 (GRCm39)	T676S	probably benign	Het
Setdb1	A	T	3: 95,245,910 (GRCm39)	F672I	probably damaging	Het
Setdb1	T	A	3: 95,254,396 (GRCm39)	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,445,456 (GRCm39)	E450G	probably benign	Het
Slc1a7	G	A	4: 107,869,473 (GRCm39)	V513M	probably benign	Het
Slc25a12	A	T	2: 71,105,533 (GRCm39)	V667E	unknown	Het
Slc39a3	T	C	10: 80,867,111 (GRCm39)	T212A	probably benign	Het
Slc45a1	C	T	4: 150,722,766 (GRCm39)	G373S	possibly damaging	Het
Snx11	G	A	11: 96,663,680 (GRCm39)	T53M	probably damaging	Het
Snx33	A	G	9: 56,832,624 (GRCm39)	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,062,966 (GRCm39)	R468C	probably damaging	Het
Stk32a	C	T	18: 43,448,166 (GRCm39)	Q382*	probably null	Het
Sun3	C	A	11: 8,973,376 (GRCm39)	S167I	probably damaging	Het
Sycp2	A	G	2: 177,996,855 (GRCm39)	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,888,955 (GRCm39)	T913P	probably damaging	Het
Trav8d-1	C	T	14: 53,016,284 (GRCm39)	Q57*	probably null	Het
Trio	C	G	15: 27,749,952 (GRCm39)	V2250L	probably benign	Het
Unc119b	A	T	5: 115,265,102 (GRCm39)	I204N	probably damaging	Het
Usp4	A	G	9: 108,255,670 (GRCm39)	E576G	probably damaging	Het
Uvssa	T	A	5: 33,566,848 (GRCm39)	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,459,649 (GRCm39)	Y43C	probably damaging	Het
Xpo6	G	A	7: 125,768,426 (GRCm39)	L94F	probably benign	Het
Zbtb11	A	G	16: 55,826,383 (GRCm39)	K804R	probably damaging	Het
Zfp616	A	G	11: 73,974,894 (GRCm39)	R479G	probably benign	Het
Zfp661	T	C	2: 127,419,844 (GRCm39)	T99A	probably benign	Het
Zfp839	A	T	12: 110,821,532 (GRCm39)	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,046,765 (GRCm39)		probably null	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTAAGATAGGCATGACTCAGAG -3'
(R):5'- GTTAGGCCCTTGATGAAATGC -3'

Sequencing Primer
(F):5'- ATTGACGTTCATTGCTACTGTAATGC -3'
(R):5'- GGCCCTTGATGAAATGCAAAATTAG -3'

Posted On

2020-01-23