Incidental Mutation 'R8022:Ctcfl'
ID617419
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene NameCCCTC-binding factor (zinc finger protein)-like
SynonymsBoris, OTTMUSG00000016680
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R8022 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location173093609-173119525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173118766 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 8 (V8D)
Ref Sequence ENSEMBL: ENSMUSP00000091845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
Predicted Effect probably benign
Transcript: ENSMUST00000094287
AA Change: V8D

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: V8D

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179693
AA Change: V8D

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: V8D

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 173094734 missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 173118331 missense probably benign 0.03
IGL01524:Ctcfl APN 2 173117384 missense probably benign 0.08
IGL02610:Ctcfl APN 2 173106026 splice site probably benign
IGL02961:Ctcfl APN 2 173101919 missense possibly damaging 0.70
BB001:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
BB011:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R0147:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0148:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 173118443 missense probably damaging 0.99
R1099:Ctcfl UTSW 2 173112360 missense probably damaging 1.00
R1540:Ctcfl UTSW 2 173112348 missense probably benign 0.36
R1892:Ctcfl UTSW 2 173118685 missense probably benign 0.24
R2036:Ctcfl UTSW 2 173101985 missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 173118506 missense probably benign 0.00
R2925:Ctcfl UTSW 2 173094696 missense probably damaging 1.00
R4327:Ctcfl UTSW 2 173113506 intron probably benign
R4837:Ctcfl UTSW 2 173113656 missense probably benign 0.00
R4894:Ctcfl UTSW 2 173117403 missense probably benign 0.19
R4909:Ctcfl UTSW 2 173095398 missense probably benign 0.42
R5128:Ctcfl UTSW 2 173117396 missense probably benign 0.00
R5247:Ctcfl UTSW 2 173113609 missense probably damaging 1.00
R6263:Ctcfl UTSW 2 173095337 missense probably benign 0.00
R6768:Ctcfl UTSW 2 173117291 missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 173112374 missense probably damaging 1.00
R7180:Ctcfl UTSW 2 173105977 splice site probably null
R7256:Ctcfl UTSW 2 173118475 missense probably benign 0.01
R7268:Ctcfl UTSW 2 173107795 missense probably benign 0.26
R7378:Ctcfl UTSW 2 173112258 missense probably damaging 1.00
R7560:Ctcfl UTSW 2 173118406 missense probably damaging 0.96
R7657:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 173117192 missense probably benign
R7924:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7945:Ctcfl UTSW 2 173118658 missense probably benign
R8038:Ctcfl UTSW 2 173101905 missense probably damaging 1.00
R8911:Ctcfl UTSW 2 173095328 critical splice donor site probably null
Z1088:Ctcfl UTSW 2 173118344 missense probably benign 0.01
Z1177:Ctcfl UTSW 2 173102036 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCTCCTCAGAGTGTGGC -3'
(R):5'- GTTGGAATATCACCTAAATCCCG -3'

Sequencing Primer
(F):5'- TAGGTGCACATCCTGGGACTC -3'
(R):5'- GGAATATCACCTAAATCCCGTTAGAG -3'
Posted On2020-01-23