Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Kcnn3'

617422

Institutional Source

Beutler Lab

Gene Symbol

Kcnn3

Ensembl Gene

ENSMUSG00000000794

Gene Name

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3

Synonyms

small conductance calcium-activated potassium channel 3, SK3

MMRRC Submission

067461-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89520164-89675132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 89609703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 473 (I473S)

Ref Sequence

ENSEMBL: ENSMUSP00000000811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000811]

AlphaFold

P58391

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000811
AA Change: I473S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: I473S

Domain	Start	End	E-Value	Type
low complexity region	30	96	N/A	INTRINSIC
low complexity region	139	154	N/A	INTRINSIC
low complexity region	213	224	N/A	INTRINSIC
Pfam:SK_channel	270	383	3.1e-51	PFAM
Pfam:Ion_trans_2	462	548	2.2e-14	PFAM
CaMBD	562	638	1.04e-49	SMART
low complexity region	684	690	N/A	INTRINSIC
low complexity region	718	731	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Igf2r	T	A	17: 12,718,795	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncam1	G	T	9: 49,564,892	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510	I88N	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,752,447	T913P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zbtb11	A	G	16: 56,006,020	K804R	probably damaging	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Kcnn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02263:Kcnn3	APN	3	89661218	missense	possibly damaging	0.73
IGL02444:Kcnn3	APN	3	89652052	missense	possibly damaging	0.50
IGL02500:Kcnn3	APN	3	89661112	splice site	probably benign
IGL02814:Kcnn3	APN	3	89521175	missense	possibly damaging	0.94
IGL02821:Kcnn3	APN	3	89662722	missense	possibly damaging	0.84
IGL02821:Kcnn3	APN	3	89520974	missense	possibly damaging	0.91
IGL02852:Kcnn3	APN	3	89609616	missense	probably damaging	0.96
IGL02942:Kcnn3	APN	3	89652076	missense	probably benign	0.00
IGL03118:Kcnn3	APN	3	89667161	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0032:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R0370:Kcnn3	UTSW	3	89667092	missense	probably damaging	0.98
R0619:Kcnn3	UTSW	3	89652030	missense	probably damaging	1.00
R1167:Kcnn3	UTSW	3	89564952	nonsense	probably null
R1255:Kcnn3	UTSW	3	89652109	missense	possibly damaging	0.84
R1643:Kcnn3	UTSW	3	89520497	missense	unknown
R1733:Kcnn3	UTSW	3	89652090	missense	probably benign	0.00
R1793:Kcnn3	UTSW	3	89609405	missense	probably benign	0.20
R1827:Kcnn3	UTSW	3	89520994	missense	possibly damaging	0.75
R1899:Kcnn3	UTSW	3	89520455	start gained	probably benign
R2055:Kcnn3	UTSW	3	89521375	missense	probably damaging	1.00
R2843:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R2922:Kcnn3	UTSW	3	89521022	missense	probably damaging	1.00
R4078:Kcnn3	UTSW	3	89661188	missense	possibly damaging	0.68
R4227:Kcnn3	UTSW	3	89521175	missense	possibly damaging	0.94
R4604:Kcnn3	UTSW	3	89520420	start gained	probably benign
R4814:Kcnn3	UTSW	3	89662724	missense	probably damaging	1.00
R4822:Kcnn3	UTSW	3	89667289	missense	possibly damaging	0.93
R5175:Kcnn3	UTSW	3	89609439	missense	probably damaging	1.00
R5211:Kcnn3	UTSW	3	89521231	missense	probably benign	0.04
R5438:Kcnn3	UTSW	3	89521298	missense	probably damaging	1.00
R5496:Kcnn3	UTSW	3	89609490	missense	possibly damaging	0.95
R6244:Kcnn3	UTSW	3	89645523	nonsense	probably null
R7391:Kcnn3	UTSW	3	89609471	missense	probably benign	0.34
R7625:Kcnn3	UTSW	3	89609670	missense	probably damaging	0.99
R7834:Kcnn3	UTSW	3	89521354	missense	probably damaging	1.00
R8110:Kcnn3	UTSW	3	89661233	missense	probably damaging	0.99
R8220:Kcnn3	UTSW	3	89661241	missense	probably benign	0.14
R8787:Kcnn3	UTSW	3	89645450	missense	possibly damaging	0.93
R9124:Kcnn3	UTSW	3	89521229	missense	possibly damaging	0.47
R9256:Kcnn3	UTSW	3	89667100	missense	probably damaging	1.00
R9612:Kcnn3	UTSW	3	89609396	missense	probably benign	0.09
Z1088:Kcnn3	UTSW	3	89667130	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89520923	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89661136	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GGCTGACGTGGACATTATTCTG -3'
(R):5'- AATATTCTACACCAGCTCTGCC -3'

Sequencing Primer
(F):5'- ATGTTCCTGCGCCTGTACCTG -3'
(R):5'- ACCAGCTCTGCCCTCCTC -3'

Posted On

2020-01-23