Incidental Mutation 'R8022:Kcnn3'
ID 617422
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms SK3, small conductance calcium-activated potassium channel 3
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.514) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 89427471-89579801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 89517010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 473 (I473S)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
AlphaFold P58391
Predicted Effect possibly damaging
Transcript: ENSMUST00000000811
AA Change: I473S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: I473S

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89,568,525 (GRCm39) missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89,559,359 (GRCm39) missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89,568,419 (GRCm39) splice site probably benign
IGL02814:Kcnn3 APN 3 89,428,482 (GRCm39) missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89,428,281 (GRCm39) missense possibly damaging 0.91
IGL02821:Kcnn3 APN 3 89,570,029 (GRCm39) missense possibly damaging 0.84
IGL02852:Kcnn3 APN 3 89,516,923 (GRCm39) missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89,559,383 (GRCm39) missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89,574,468 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R0370:Kcnn3 UTSW 3 89,574,399 (GRCm39) missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89,559,337 (GRCm39) missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89,472,259 (GRCm39) nonsense probably null
R1255:Kcnn3 UTSW 3 89,559,416 (GRCm39) missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89,427,804 (GRCm39) missense unknown
R1733:Kcnn3 UTSW 3 89,559,397 (GRCm39) missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89,516,712 (GRCm39) missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89,428,301 (GRCm39) missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89,427,762 (GRCm39) start gained probably benign
R2055:Kcnn3 UTSW 3 89,428,682 (GRCm39) missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R2922:Kcnn3 UTSW 3 89,428,329 (GRCm39) missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89,568,495 (GRCm39) missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89,428,482 (GRCm39) missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89,427,727 (GRCm39) start gained probably benign
R4814:Kcnn3 UTSW 3 89,570,031 (GRCm39) missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89,574,596 (GRCm39) missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89,516,746 (GRCm39) missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89,428,538 (GRCm39) missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89,428,605 (GRCm39) missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89,516,797 (GRCm39) missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89,552,830 (GRCm39) nonsense probably null
R7391:Kcnn3 UTSW 3 89,516,778 (GRCm39) missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89,516,977 (GRCm39) missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89,428,661 (GRCm39) missense probably damaging 1.00
R8110:Kcnn3 UTSW 3 89,568,540 (GRCm39) missense probably damaging 0.99
R8220:Kcnn3 UTSW 3 89,568,548 (GRCm39) missense probably benign 0.14
R8787:Kcnn3 UTSW 3 89,552,757 (GRCm39) missense possibly damaging 0.93
R9124:Kcnn3 UTSW 3 89,428,536 (GRCm39) missense possibly damaging 0.47
R9256:Kcnn3 UTSW 3 89,574,407 (GRCm39) missense probably damaging 1.00
R9612:Kcnn3 UTSW 3 89,516,703 (GRCm39) missense probably benign 0.09
Z1088:Kcnn3 UTSW 3 89,574,437 (GRCm39) missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89,568,443 (GRCm39) missense possibly damaging 0.72
Z1177:Kcnn3 UTSW 3 89,428,230 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGACGTGGACATTATTCTG -3'
(R):5'- AATATTCTACACCAGCTCTGCC -3'

Sequencing Primer
(F):5'- ATGTTCCTGCGCCTGTACCTG -3'
(R):5'- ACCAGCTCTGCCCTCCTC -3'
Posted On 2020-01-23