Incidental Mutation 'R8022:Setdb1'
ID 617423
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene Name SET domain, bifurcated 1
Synonyms KMT1E, ESET
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 95230836-95264513 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95245910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 672 (F672I)
Ref Sequence ENSEMBL: ENSMUSP00000015841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000107170] [ENSMUST00000107171]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000015841
AA Change: F672I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697
AA Change: F672I

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107170
AA Change: F672I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697
AA Change: F672I

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107171
AA Change: F671I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697
AA Change: F671I

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95,245,888 (GRCm39) missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95,254,099 (GRCm39) missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95,245,891 (GRCm39) nonsense probably null
IGL01710:Setdb1 APN 3 95,246,164 (GRCm39) missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95,234,684 (GRCm39) missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95,247,215 (GRCm39) splice site probably benign
IGL02838:Setdb1 APN 3 95,244,579 (GRCm39) splice site probably null
IGL03014:Setdb1 UTSW 3 95,248,726 (GRCm39) missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95,248,762 (GRCm39) missense probably damaging 1.00
R0344:Setdb1 UTSW 3 95,233,442 (GRCm39) unclassified probably benign
R0367:Setdb1 UTSW 3 95,257,192 (GRCm39) splice site probably benign
R0374:Setdb1 UTSW 3 95,232,164 (GRCm39) unclassified probably benign
R0411:Setdb1 UTSW 3 95,234,997 (GRCm39) missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95,246,140 (GRCm39) missense probably benign 0.00
R0521:Setdb1 UTSW 3 95,246,140 (GRCm39) missense probably benign 0.00
R0616:Setdb1 UTSW 3 95,249,109 (GRCm39) missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95,246,171 (GRCm39) missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95,247,576 (GRCm39) missense probably benign 0.00
R1263:Setdb1 UTSW 3 95,234,922 (GRCm39) missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95,257,187 (GRCm39) splice site probably benign
R1497:Setdb1 UTSW 3 95,234,778 (GRCm39) missense probably benign 0.44
R2885:Setdb1 UTSW 3 95,247,506 (GRCm39) missense probably benign
R2907:Setdb1 UTSW 3 95,234,512 (GRCm39) splice site probably benign
R3236:Setdb1 UTSW 3 95,246,065 (GRCm39) missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95,246,065 (GRCm39) missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95,248,649 (GRCm39) missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95,234,808 (GRCm39) missense probably damaging 0.96
R5284:Setdb1 UTSW 3 95,234,881 (GRCm39) missense probably damaging 1.00
R5484:Setdb1 UTSW 3 95,244,569 (GRCm39) missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95,246,153 (GRCm39) missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95,247,618 (GRCm39) missense probably damaging 1.00
R6610:Setdb1 UTSW 3 95,235,888 (GRCm39) missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95,231,460 (GRCm39) missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95,233,712 (GRCm39) missense probably benign 0.09
R7176:Setdb1 UTSW 3 95,244,458 (GRCm39) critical splice donor site probably null
R7250:Setdb1 UTSW 3 95,261,852 (GRCm39) critical splice donor site probably null
R7259:Setdb1 UTSW 3 95,247,224 (GRCm39) missense probably benign 0.08
R7282:Setdb1 UTSW 3 95,245,985 (GRCm39) missense probably damaging 1.00
R7497:Setdb1 UTSW 3 95,249,139 (GRCm39) missense probably damaging 1.00
R7553:Setdb1 UTSW 3 95,254,076 (GRCm39) missense probably damaging 1.00
R7921:Setdb1 UTSW 3 95,233,710 (GRCm39) missense possibly damaging 0.85
R8022:Setdb1 UTSW 3 95,254,396 (GRCm39) missense probably damaging 1.00
R8189:Setdb1 UTSW 3 95,254,022 (GRCm39) missense probably damaging 1.00
R8558:Setdb1 UTSW 3 95,261,979 (GRCm39) missense possibly damaging 0.88
R8693:Setdb1 UTSW 3 95,249,041 (GRCm39) missense probably damaging 0.99
R8812:Setdb1 UTSW 3 95,263,371 (GRCm39) missense probably damaging 1.00
R8940:Setdb1 UTSW 3 95,263,483 (GRCm39) missense probably benign
R9207:Setdb1 UTSW 3 95,246,113 (GRCm39) missense possibly damaging 0.82
R9509:Setdb1 UTSW 3 95,261,900 (GRCm39) missense possibly damaging 0.48
R9784:Setdb1 UTSW 3 95,233,173 (GRCm39) missense probably damaging 1.00
Z1177:Setdb1 UTSW 3 95,245,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGAAATTCAGGGCCTG -3'
(R):5'- ACAGTATCGGGGCAAGAACC -3'

Sequencing Primer
(F):5'- CCAGAAATTCAGGGCCTGTGTTAATG -3'
(R):5'- GGCAAGAACCCTCTATTAGTTCC -3'
Posted On 2020-01-23