Incidental Mutation 'R8022:Kcnd3'
ID 617425
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Name potassium voltage-gated channel, Shal-related family, member 3
Synonyms Kv4.3, potassium channel Kv4.3L, potassium channel Kv4.3M
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 105359646-105581318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105366189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 20 (M20V)
Ref Sequence ENSEMBL: ENSMUSP00000078169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
AlphaFold Q9Z0V1
Predicted Effect probably benign
Transcript: ENSMUST00000079169
AA Change: M20V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: M20V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098761
AA Change: M20V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: M20V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118360
AA Change: M20V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: M20V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105,574,317 (GRCm39) nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105,566,025 (GRCm39) missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105,366,942 (GRCm39) missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105,566,075 (GRCm39) missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105,575,502 (GRCm39) missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105,367,068 (GRCm39) missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105,366,853 (GRCm39) missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105,574,315 (GRCm39) missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105,576,442 (GRCm39) missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105,575,541 (GRCm39) missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105,566,082 (GRCm39) missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105,566,070 (GRCm39) missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105,574,244 (GRCm39) intron probably benign
R5849:Kcnd3 UTSW 3 105,366,111 (GRCm39) utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105,366,856 (GRCm39) missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105,576,400 (GRCm39) missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105,575,526 (GRCm39) missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105,366,933 (GRCm39) missense probably benign 0.08
R7975:Kcnd3 UTSW 3 105,366,310 (GRCm39) missense probably damaging 1.00
R8823:Kcnd3 UTSW 3 105,574,330 (GRCm39) missense probably benign 0.00
R8986:Kcnd3 UTSW 3 105,367,039 (GRCm39) missense probably damaging 1.00
R9056:Kcnd3 UTSW 3 105,574,290 (GRCm39) missense possibly damaging 0.48
R9345:Kcnd3 UTSW 3 105,566,003 (GRCm39) missense probably damaging 1.00
R9513:Kcnd3 UTSW 3 105,572,863 (GRCm39) critical splice donor site probably null
Z1177:Kcnd3 UTSW 3 105,366,886 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAAAGTGGACTCAGCCCCTTTC -3'
(R):5'- GTGCGGTAGAAGTTAAGCACAC -3'

Sequencing Primer
(F):5'- GGACTCAGCCCCTTTCTCTGC -3'
(R):5'- CCTTCGTGTCCTCATTGAAGAAGAAC -3'
Posted On 2020-01-23