Incidental Mutation 'R8022:Chd7'
ID 617427
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Name chromodomain helicase DNA binding protein 7
Synonyms Whi, Dz, Cyn, GENA 47, Cycn, Lda, Flo, Obt, Edy, A730019I05Rik, Todo, GENA 60, WBE1, Gena 52, Mt
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 8690406-8867659 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8751605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000118711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000127476] [ENSMUST00000129655] [ENSMUST00000170391]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000039267
AA Change: V34E
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000051558
AA Change: V34E
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127476
AA Change: V34E
SMART Domains Protein: ENSMUSP00000118711
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
Blast:CHROMO 596 630 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129655
Predicted Effect unknown
Transcript: ENSMUST00000170391
AA Change: V34E
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8,859,106 (GRCm39) missense probably damaging 1.00
IGL00510:Chd7 APN 4 8,801,404 (GRCm39) missense probably damaging 1.00
IGL00741:Chd7 APN 4 8,839,454 (GRCm39) missense probably damaging 1.00
IGL00796:Chd7 APN 4 8,847,271 (GRCm39) missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8,840,435 (GRCm39) missense probably damaging 0.98
IGL00930:Chd7 APN 4 8,805,181 (GRCm39) missense probably damaging 1.00
IGL01542:Chd7 APN 4 8,859,285 (GRCm39) missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01605:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01670:Chd7 APN 4 8,827,033 (GRCm39) missense probably damaging 0.98
IGL02434:Chd7 APN 4 8,752,145 (GRCm39) missense probably benign 0.00
IGL02531:Chd7 APN 4 8,854,134 (GRCm39) missense probably damaging 1.00
IGL02626:Chd7 APN 4 8,826,519 (GRCm39) missense probably damaging 1.00
IGL02961:Chd7 APN 4 8,751,542 (GRCm39) missense probably damaging 1.00
IGL02972:Chd7 APN 4 8,855,174 (GRCm39) missense probably benign 0.30
IGL03329:Chd7 APN 4 8,841,108 (GRCm39) missense probably damaging 1.00
Fili UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
D4043:Chd7 UTSW 4 8,862,650 (GRCm39) missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8,828,398 (GRCm39) missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
PIT4472001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
R0157:Chd7 UTSW 4 8,833,759 (GRCm39) missense probably damaging 1.00
R0179:Chd7 UTSW 4 8,862,516 (GRCm39) missense probably benign 0.22
R0240:Chd7 UTSW 4 8,852,670 (GRCm39) unclassified probably benign
R0388:Chd7 UTSW 4 8,854,560 (GRCm39) missense probably benign 0.27
R0462:Chd7 UTSW 4 8,850,821 (GRCm39) missense probably damaging 1.00
R0512:Chd7 UTSW 4 8,805,139 (GRCm39) intron probably benign
R0657:Chd7 UTSW 4 8,753,141 (GRCm39) missense probably damaging 1.00
R0799:Chd7 UTSW 4 8,801,310 (GRCm39) intron probably benign
R0885:Chd7 UTSW 4 8,866,432 (GRCm39) missense probably damaging 1.00
R1056:Chd7 UTSW 4 8,822,402 (GRCm39) missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8,866,458 (GRCm39) missense probably benign 0.04
R1353:Chd7 UTSW 4 8,839,556 (GRCm39) missense probably damaging 0.99
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1605:Chd7 UTSW 4 8,844,675 (GRCm39) missense probably damaging 1.00
R1693:Chd7 UTSW 4 8,864,307 (GRCm39) critical splice donor site probably null
R1695:Chd7 UTSW 4 8,833,960 (GRCm39) missense probably damaging 1.00
R1938:Chd7 UTSW 4 8,847,200 (GRCm39) missense probably damaging 1.00
R1964:Chd7 UTSW 4 8,865,978 (GRCm39) missense probably damaging 0.96
R2020:Chd7 UTSW 4 8,855,226 (GRCm39) missense probably benign 0.00
R2134:Chd7 UTSW 4 8,753,147 (GRCm39) missense probably damaging 0.99
R2171:Chd7 UTSW 4 8,752,424 (GRCm39) missense probably damaging 1.00
R2271:Chd7 UTSW 4 8,785,532 (GRCm39) missense probably damaging 1.00
R2300:Chd7 UTSW 4 8,855,241 (GRCm39) missense probably benign 0.02
R2355:Chd7 UTSW 4 8,801,350 (GRCm39) missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8,855,174 (GRCm39) missense probably benign 0.30
R3430:Chd7 UTSW 4 8,844,517 (GRCm39) missense probably damaging 0.99
R3746:Chd7 UTSW 4 8,752,537 (GRCm39) missense probably damaging 1.00
R4118:Chd7 UTSW 4 8,865,831 (GRCm39) missense probably damaging 1.00
R4119:Chd7 UTSW 4 8,785,658 (GRCm39) intron probably benign
R4332:Chd7 UTSW 4 8,854,143 (GRCm39) missense probably damaging 1.00
R4402:Chd7 UTSW 4 8,866,353 (GRCm39) missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8,866,217 (GRCm39) missense probably benign 0.09
R4722:Chd7 UTSW 4 8,822,445 (GRCm39) missense probably damaging 1.00
R4821:Chd7 UTSW 4 8,844,706 (GRCm39) missense probably damaging 1.00
R4894:Chd7 UTSW 4 8,838,629 (GRCm39) missense probably damaging 0.99
R5205:Chd7 UTSW 4 8,752,509 (GRCm39) missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8,844,417 (GRCm39) missense probably damaging 1.00
R5484:Chd7 UTSW 4 8,828,258 (GRCm39) missense probably damaging 1.00
R5578:Chd7 UTSW 4 8,847,149 (GRCm39) missense probably benign 0.09
R5583:Chd7 UTSW 4 8,752,473 (GRCm39) missense probably damaging 1.00
R5888:Chd7 UTSW 4 8,866,382 (GRCm39) missense probably damaging 0.98
R5905:Chd7 UTSW 4 8,840,553 (GRCm39) missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8,751,875 (GRCm39) missense probably damaging 0.99
R6126:Chd7 UTSW 4 8,826,482 (GRCm39) missense probably damaging 1.00
R6399:Chd7 UTSW 4 8,828,274 (GRCm39) missense probably damaging 1.00
R6751:Chd7 UTSW 4 8,833,866 (GRCm39) missense probably damaging 1.00
R6810:Chd7 UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
R6868:Chd7 UTSW 4 8,811,501 (GRCm39) splice site probably null
R6952:Chd7 UTSW 4 8,856,797 (GRCm39) missense probably damaging 1.00
R6986:Chd7 UTSW 4 8,859,285 (GRCm39) missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8,844,525 (GRCm39) missense probably benign 0.28
R7139:Chd7 UTSW 4 8,865,865 (GRCm39) missense probably benign 0.00
R7288:Chd7 UTSW 4 8,847,093 (GRCm39) missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8,752,196 (GRCm39) missense unknown
R7452:Chd7 UTSW 4 8,854,731 (GRCm39) missense probably benign 0.03
R7471:Chd7 UTSW 4 8,859,197 (GRCm39) missense probably damaging 0.96
R7588:Chd7 UTSW 4 8,864,039 (GRCm39) missense probably damaging 1.00
R7711:Chd7 UTSW 4 8,805,234 (GRCm39) missense probably benign 0.00
R7744:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R7842:Chd7 UTSW 4 8,854,115 (GRCm39) missense probably benign 0.01
R7883:Chd7 UTSW 4 8,826,504 (GRCm39) missense probably damaging 1.00
R7934:Chd7 UTSW 4 8,854,121 (GRCm39) missense probably benign 0.00
R7983:Chd7 UTSW 4 8,844,609 (GRCm39) missense possibly damaging 0.47
R7983:Chd7 UTSW 4 8,752,628 (GRCm39) missense unknown
R8161:Chd7 UTSW 4 8,855,038 (GRCm39) missense probably damaging 1.00
R8274:Chd7 UTSW 4 8,839,432 (GRCm39) missense probably damaging 1.00
R8278:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R8358:Chd7 UTSW 4 8,839,529 (GRCm39) missense probably damaging 1.00
R8464:Chd7 UTSW 4 8,811,465 (GRCm39) missense probably benign 0.06
R8483:Chd7 UTSW 4 8,822,412 (GRCm39) missense possibly damaging 0.65
R8507:Chd7 UTSW 4 8,858,675 (GRCm39) missense probably damaging 1.00
R8535:Chd7 UTSW 4 8,859,211 (GRCm39) missense possibly damaging 0.92
R8695:Chd7 UTSW 4 8,850,812 (GRCm39) missense probably damaging 1.00
R8700:Chd7 UTSW 4 8,833,892 (GRCm39) missense probably damaging 1.00
R8755:Chd7 UTSW 4 8,866,069 (GRCm39) missense probably benign 0.31
R8774:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8796:Chd7 UTSW 4 8,838,691 (GRCm39) missense probably damaging 1.00
R8992:Chd7 UTSW 4 8,839,589 (GRCm39) missense probably damaging 1.00
R9018:Chd7 UTSW 4 8,847,083 (GRCm39) missense possibly damaging 0.88
R9122:Chd7 UTSW 4 8,840,510 (GRCm39) missense possibly damaging 0.77
R9131:Chd7 UTSW 4 8,785,642 (GRCm39) missense
R9182:Chd7 UTSW 4 8,838,737 (GRCm39) missense probably damaging 1.00
R9227:Chd7 UTSW 4 8,805,272 (GRCm39) missense probably benign 0.03
R9254:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9379:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9388:Chd7 UTSW 4 8,865,756 (GRCm39) missense possibly damaging 0.89
R9455:Chd7 UTSW 4 8,752,061 (GRCm39) missense unknown
R9531:Chd7 UTSW 4 8,858,489 (GRCm39) missense
R9577:Chd7 UTSW 4 8,752,964 (GRCm39) missense unknown
R9634:Chd7 UTSW 4 8,832,499 (GRCm39) missense probably damaging 1.00
Z1176:Chd7 UTSW 4 8,844,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTTTTGAGGACAAGCACC -3'
(R):5'- GTGATACTGTGAGTGCGGAGAC -3'

Sequencing Primer
(F):5'- GGACAAGCACCCCAGAAAAGTG -3'
(R):5'- GGAGACGCCAATCCGTTC -3'
Posted On 2020-01-23