Incidental Mutation 'R8022:Chd7'
ID617427
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8022 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8751605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000118711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000127476] [ENSMUST00000129655] [ENSMUST00000170391]
Predicted Effect unknown
Transcript: ENSMUST00000039267
AA Change: V34E
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000051558
AA Change: V34E
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127476
AA Change: V34E
SMART Domains Protein: ENSMUSP00000118711
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
Blast:CHROMO 596 630 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129655
Predicted Effect unknown
Transcript: ENSMUST00000170391
AA Change: V34E
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
R7588:Chd7 UTSW 4 8864039 missense probably damaging 1.00
R7711:Chd7 UTSW 4 8805234 missense probably benign 0.00
R7744:Chd7 UTSW 4 8862485 splice site probably null
R7842:Chd7 UTSW 4 8854115 missense probably benign 0.01
R7883:Chd7 UTSW 4 8826504 missense probably damaging 1.00
R7934:Chd7 UTSW 4 8854121 missense probably benign 0.00
R7983:Chd7 UTSW 4 8752628 missense unknown
R7983:Chd7 UTSW 4 8844609 missense possibly damaging 0.47
R8161:Chd7 UTSW 4 8855038 missense probably damaging 1.00
R8274:Chd7 UTSW 4 8839432 missense probably damaging 1.00
R8278:Chd7 UTSW 4 8862485 splice site probably null
R8358:Chd7 UTSW 4 8839529 missense probably damaging 1.00
R8464:Chd7 UTSW 4 8811465 missense probably benign 0.06
R8483:Chd7 UTSW 4 8822412 missense possibly damaging 0.65
R8507:Chd7 UTSW 4 8858675 missense probably damaging 1.00
R8535:Chd7 UTSW 4 8859211 missense possibly damaging 0.92
R8695:Chd7 UTSW 4 8850812 missense probably damaging 1.00
R8700:Chd7 UTSW 4 8833892 missense probably damaging 1.00
R8755:Chd7 UTSW 4 8866069 missense probably benign 0.31
R8774:Chd7 UTSW 4 8854692 missense probably damaging 1.00
R8774-TAIL:Chd7 UTSW 4 8854692 missense probably damaging 1.00
R8796:Chd7 UTSW 4 8838691 missense probably damaging 1.00
Z1176:Chd7 UTSW 4 8844313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTTTTGAGGACAAGCACC -3'
(R):5'- GTGATACTGTGAGTGCGGAGAC -3'

Sequencing Primer
(F):5'- GGACAAGCACCCCAGAAAAGTG -3'
(R):5'- GGAGACGCCAATCCGTTC -3'
Posted On2020-01-23