Mutagenetix > Incidental Mutations

Incidental Mutation 'R8022:Nr4a3'

617429

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48051510 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 88 (I88N)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030025
AA Change: I88N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: I88N

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: I117N

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Igf2r	T	A	17: 12,718,795	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Kcnn3	T	G	3: 89,609,703	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncam1	G	T	9: 49,564,892	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,752,447	T913P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zbtb11	A	G	16: 56,006,020	K804R	probably damaging	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- ATGGCTCGGAATACACCACAG -3'
(R):5'- TTCATCTGCGGGTCCAGCA -3'

Sequencing Primer
(F):5'- GCTCGGAATACACCACAGAAATCATG -3'
(R):5'- AGCTCGTCGTCCCACAG -3'

Posted On

2020-01-23