Incidental Mutation 'R8022:Ambp'
ID 617430
Institutional Source Beutler Lab
Gene Symbol Ambp
Ensembl Gene ENSMUSG00000028356
Gene Name alpha 1 microglobulin/bikunin
Synonyms UTI, Urinary Trypsin Inhibitor, ulinastatin, Itil, HI-30, Intin4, ASPI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 63143275-63154799 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 63144197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 268 (N268K)
Ref Sequence ENSEMBL: ENSMUSP00000030041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030041] [ENSMUST00000107415]
AlphaFold Q07456
Predicted Effect probably damaging
Transcript: ENSMUST00000030041
AA Change: N268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030041
Gene: ENSMUSG00000028356
AA Change: N268K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 40 185 4.4e-32 PFAM
KU 228 281 1.55e-20 SMART
KU 284 337 4.58e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107415
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a fusion protein that undergoes proteolytic processing to generate two mature proteins: alpha-1-microglobulin (A1m) is a heme-binding plasma glycoprotein of the lipocalin superfamily of proteins that bind to hydrophobic molecules, whereas bikunin belongs to the superfamily of Kunitz-type protease inhibitors. The transgenic mice specifically lacking bikunin, but not A1m, exhibit female infertility and an increased sensitivity to lung metastasis. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female homozygotes for targeted null mutations exhibit reduced ovulation rates, oocytes lacking a zona pellucida, and a very low fertilization rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Ambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Ambp APN 4 63154018 missense possibly damaging 0.93
IGL00769:Ambp APN 4 63144165 missense probably damaging 0.99
IGL01400:Ambp APN 4 63152722 missense probably damaging 1.00
IGL01646:Ambp APN 4 63148740 missense probably benign 0.04
IGL02338:Ambp APN 4 63143697 missense probably damaging 1.00
IGL02796:Ambp APN 4 63153932 splice site probably benign
PIT4131001:Ambp UTSW 4 63144265 missense probably damaging 1.00
PIT4791001:Ambp UTSW 4 63154061 start gained probably benign
R0885:Ambp UTSW 4 63151468 missense probably damaging 0.98
R1725:Ambp UTSW 4 63144276 missense possibly damaging 0.92
R1999:Ambp UTSW 4 63149429 missense possibly damaging 0.63
R2023:Ambp UTSW 4 63151465 missense probably damaging 1.00
R2290:Ambp UTSW 4 63143687 missense probably damaging 1.00
R3436:Ambp UTSW 4 63149484 missense probably benign 0.03
R3437:Ambp UTSW 4 63149484 missense probably benign 0.03
R4078:Ambp UTSW 4 63150443 missense probably damaging 0.98
R4409:Ambp UTSW 4 63152647 missense probably damaging 1.00
R4979:Ambp UTSW 4 63152651 missense probably benign 0.07
R6738:Ambp UTSW 4 63149474 missense probably benign
R6818:Ambp UTSW 4 63154006 nonsense probably null
R6890:Ambp UTSW 4 63150359 missense probably benign 0.44
R7934:Ambp UTSW 4 63149440 missense probably damaging 1.00
R8671:Ambp UTSW 4 63150419 nonsense probably null
R8969:Ambp UTSW 4 63154091 start gained probably benign
X0057:Ambp UTSW 4 63149505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAATATGACTGACCCAGGC -3'
(R):5'- TCGGCATGGTGGTGCATATC -3'

Sequencing Primer
(F):5'- AGGCCACCTGCATCTACATGTG -3'
(R):5'- GTGCATATCACGTTGTACACAGGTC -3'
Posted On 2020-01-23