Incidental Mutation 'R8022:Slc45a1'
ID 617436
Institutional Source Beutler Lab
Gene Symbol Slc45a1
Ensembl Gene ENSMUSG00000039838
Gene Name solute carrier family 45, member 1
Synonyms Dnb5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 150628572-150652174 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 150638309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 373 (G373S)
Ref Sequence ENSEMBL: ENSMUSP00000036774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037827] [ENSMUST00000117997]
AlphaFold Q8BIV7
Predicted Effect possibly damaging
Transcript: ENSMUST00000037827
AA Change: G373S

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036774
Gene: ENSMUSG00000039838
AA Change: G373S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 86 310 7.3e-11 PFAM
Pfam:MFS_1 92 356 1.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 680 702 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117997
AA Change: G373S

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112737
Gene: ENSMUSG00000039838
AA Change: G373S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 87 307 1.6e-12 PFAM
Pfam:MFS_1 92 362 2.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Slc45a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Slc45a1 APN 4 150643969 missense probably damaging 1.00
IGL02009:Slc45a1 APN 4 150637990 missense probably damaging 1.00
IGL02251:Slc45a1 APN 4 150638719 splice site probably benign
IGL02752:Slc45a1 APN 4 150638021 missense probably benign 0.01
IGL02881:Slc45a1 APN 4 150638530 missense probably benign 0.36
PIT4508001:Slc45a1 UTSW 4 150638435 missense probably benign 0.00
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0449:Slc45a1 UTSW 4 150643305 missense probably damaging 1.00
R0756:Slc45a1 UTSW 4 150642597 frame shift probably null
R1435:Slc45a1 UTSW 4 150644048 missense probably damaging 1.00
R1837:Slc45a1 UTSW 4 150638459 missense probably benign 0.00
R1943:Slc45a1 UTSW 4 150644277 missense probably benign 0.02
R2186:Slc45a1 UTSW 4 150638251 missense probably benign 0.01
R3766:Slc45a1 UTSW 4 150638060 missense probably damaging 1.00
R4689:Slc45a1 UTSW 4 150638539 missense probably benign 0.31
R4697:Slc45a1 UTSW 4 150638284 missense probably damaging 1.00
R4709:Slc45a1 UTSW 4 150638240 missense probably benign 0.04
R5253:Slc45a1 UTSW 4 150638270 missense probably damaging 0.98
R5387:Slc45a1 UTSW 4 150643909 intron probably benign
R5914:Slc45a1 UTSW 4 150629540 missense possibly damaging 0.57
R6259:Slc45a1 UTSW 4 150638360 missense possibly damaging 0.63
R6290:Slc45a1 UTSW 4 150642639 missense probably damaging 1.00
R6961:Slc45a1 UTSW 4 150629653 missense probably damaging 0.99
R6981:Slc45a1 UTSW 4 150638594 missense possibly damaging 0.48
R7099:Slc45a1 UTSW 4 150629573 missense probably benign 0.00
R7209:Slc45a1 UTSW 4 150635212 splice site probably null
R7601:Slc45a1 UTSW 4 150629537 missense possibly damaging 0.78
R7615:Slc45a1 UTSW 4 150638545 missense probably benign 0.01
R7730:Slc45a1 UTSW 4 150630940 missense probably damaging 1.00
R7750:Slc45a1 UTSW 4 150644041 missense probably damaging 1.00
R8768:Slc45a1 UTSW 4 150629749 missense probably damaging 0.98
R9006:Slc45a1 UTSW 4 150638274 missense probably damaging 1.00
R9258:Slc45a1 UTSW 4 150638614 missense possibly damaging 0.88
R9388:Slc45a1 UTSW 4 150642610 missense probably damaging 1.00
X0026:Slc45a1 UTSW 4 150644050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAGCACATCTCCATCCGAG -3'
(R):5'- CTATGAAGAGCCCAAGCCTC -3'

Sequencing Primer
(F):5'- ATCCGAGCCCAAGGTGAG -3'
(R):5'- GAGCCCAAGCCTCCCATTG -3'
Posted On 2020-01-23