Incidental Mutation 'R8022:Magi1'
ID 617448
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms Baiap1, Gukmi1, AIP3, BAP1, WWP3
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.593) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 93652436-94260898 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93674346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 962 (S962G)
Ref Sequence ENSEMBL: ENSMUSP00000086730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
AlphaFold Q6RHR9
PDB Structure X-ray crystal structure of MAGI-1 PDZ1 bound to the C-terminal peptide of HPV18 E6 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000055224
AA Change: S921G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095
AA Change: S921G

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089317
AA Change: S962G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: S962G

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093769
AA Change: S734G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: S734G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203519
AA Change: S933G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095
AA Change: S933G

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203688
AA Change: S735G

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: S735G

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204347
AA Change: S962G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: S962G

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94,260,074 (GRCm39) missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93,724,205 (GRCm39) missense probably damaging 0.99
IGL01642:Magi1 APN 6 93,663,605 (GRCm39) missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93,769,381 (GRCm39) splice site probably null
IGL01967:Magi1 APN 6 93,685,115 (GRCm39) missense probably damaging 1.00
IGL01984:Magi1 APN 6 93,685,155 (GRCm39) missense probably damaging 1.00
IGL02074:Magi1 APN 6 93,722,579 (GRCm39) missense probably damaging 1.00
IGL02098:Magi1 APN 6 93,655,768 (GRCm39) missense probably damaging 1.00
IGL02225:Magi1 APN 6 93,671,007 (GRCm39) missense probably damaging 1.00
IGL02522:Magi1 APN 6 93,655,617 (GRCm39) missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93,762,591 (GRCm39) missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93,663,854 (GRCm39) missense probably damaging 1.00
P0007:Magi1 UTSW 6 93,722,969 (GRCm39) missense probably damaging 1.00
R0149:Magi1 UTSW 6 93,724,226 (GRCm39) missense probably damaging 1.00
R0512:Magi1 UTSW 6 93,671,045 (GRCm39) missense probably damaging 1.00
R1487:Magi1 UTSW 6 93,685,060 (GRCm39) missense probably benign 0.00
R1497:Magi1 UTSW 6 93,724,310 (GRCm39) missense probably damaging 1.00
R1502:Magi1 UTSW 6 93,671,151 (GRCm39) missense probably damaging 1.00
R1824:Magi1 UTSW 6 93,676,620 (GRCm39) missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93,732,026 (GRCm39) missense probably benign
R2132:Magi1 UTSW 6 93,674,255 (GRCm39) missense probably damaging 0.99
R2331:Magi1 UTSW 6 93,662,543 (GRCm39) missense probably damaging 1.00
R2418:Magi1 UTSW 6 93,722,891 (GRCm39) missense probably damaging 1.00
R3076:Magi1 UTSW 6 93,734,668 (GRCm39) missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93,676,610 (GRCm39) missense probably damaging 0.98
R4005:Magi1 UTSW 6 93,678,299 (GRCm39) missense probably damaging 1.00
R4455:Magi1 UTSW 6 93,762,438 (GRCm39) missense probably damaging 1.00
R4670:Magi1 UTSW 6 93,663,624 (GRCm39) splice site probably null
R4671:Magi1 UTSW 6 93,657,768 (GRCm39) critical splice donor site probably null
R4839:Magi1 UTSW 6 93,671,177 (GRCm39) missense probably damaging 1.00
R5132:Magi1 UTSW 6 93,660,072 (GRCm39) critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93,724,248 (GRCm39) missense probably damaging 1.00
R5525:Magi1 UTSW 6 93,769,354 (GRCm39) missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93,722,682 (GRCm39) missense probably damaging 1.00
R5724:Magi1 UTSW 6 93,657,852 (GRCm39) missense probably benign 0.03
R5846:Magi1 UTSW 6 93,662,584 (GRCm39) missense probably damaging 1.00
R5896:Magi1 UTSW 6 93,685,180 (GRCm39) missense probably damaging 1.00
R5912:Magi1 UTSW 6 93,685,126 (GRCm39) missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93,722,571 (GRCm39) missense probably damaging 1.00
R6115:Magi1 UTSW 6 93,685,051 (GRCm39) missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93,920,210 (GRCm39) missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94,260,177 (GRCm39) missense probably benign 0.06
R6457:Magi1 UTSW 6 93,676,620 (GRCm39) missense probably damaging 1.00
R6464:Magi1 UTSW 6 93,676,770 (GRCm39) missense probably damaging 1.00
R6613:Magi1 UTSW 6 93,722,654 (GRCm39) missense probably damaging 1.00
R6661:Magi1 UTSW 6 93,920,289 (GRCm39) missense probably benign 0.08
R6755:Magi1 UTSW 6 93,685,158 (GRCm39) missense probably damaging 1.00
R6909:Magi1 UTSW 6 93,674,301 (GRCm39) missense probably damaging 1.00
R7180:Magi1 UTSW 6 93,792,731 (GRCm39) missense probably benign 0.10
R7224:Magi1 UTSW 6 93,660,070 (GRCm39) missense probably benign 0.34
R7447:Magi1 UTSW 6 93,722,562 (GRCm39) missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93,685,189 (GRCm39) missense probably damaging 0.99
R7537:Magi1 UTSW 6 93,685,091 (GRCm39) nonsense probably null
R7549:Magi1 UTSW 6 93,685,095 (GRCm39) missense probably benign 0.19
R7566:Magi1 UTSW 6 93,655,308 (GRCm39) missense probably benign 0.03
R7805:Magi1 UTSW 6 93,659,927 (GRCm39) missense probably benign
R8290:Magi1 UTSW 6 94,260,066 (GRCm39) missense probably damaging 1.00
R8519:Magi1 UTSW 6 93,681,330 (GRCm39) missense possibly damaging 0.83
R8762:Magi1 UTSW 6 93,792,789 (GRCm39) nonsense probably null
R8894:Magi1 UTSW 6 93,663,586 (GRCm39) missense probably benign 0.12
R8974:Magi1 UTSW 6 93,674,223 (GRCm39) missense probably damaging 1.00
R9225:Magi1 UTSW 6 93,762,511 (GRCm39) missense possibly damaging 0.64
R9277:Magi1 UTSW 6 93,920,234 (GRCm39) missense possibly damaging 0.48
R9300:Magi1 UTSW 6 93,724,209 (GRCm39) missense probably damaging 1.00
R9393:Magi1 UTSW 6 93,659,890 (GRCm39) missense probably benign 0.27
R9402:Magi1 UTSW 6 94,260,278 (GRCm39) missense probably benign 0.00
R9432:Magi1 UTSW 6 93,660,058 (GRCm39) missense probably damaging 1.00
R9567:Magi1 UTSW 6 93,659,931 (GRCm39) critical splice donor site probably null
R9567:Magi1 UTSW 6 93,655,431 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAAGGCAGTAAACATCCTAAAC -3'
(R):5'- TCCATCTTCTGGGGATCAAATGG -3'

Sequencing Primer
(F):5'- GGCAGTAAACATCCTAAACTGGGAC -3'
(R):5'- GGTTTAAACACACATCTCTCTTGCAG -3'
Posted On 2020-01-23