Incidental Mutation 'R8022:Ankrd11'
ID617459
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8022 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122887593 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2503 (K2503E)
Ref Sequence ENSEMBL: ENSMUSP00000095938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect probably damaging
Transcript: ENSMUST00000098333
AA Change: K2503E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: K2503E

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098334
AA Change: K2482E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: K2482E

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
Navy UTSW 8 122908734 nonsense probably null
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 unclassified probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 unclassified probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6145:Ankrd11 UTSW 8 122892661 missense probably damaging 1.00
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
R7477:Ankrd11 UTSW 8 122894385 missense possibly damaging 0.91
R7534:Ankrd11 UTSW 8 122894410 missense probably damaging 1.00
R7555:Ankrd11 UTSW 8 122887406 missense probably damaging 0.99
R7627:Ankrd11 UTSW 8 122890951 missense possibly damaging 0.63
R7658:Ankrd11 UTSW 8 122893664 missense probably benign
R7721:Ankrd11 UTSW 8 122894759 missense probably damaging 1.00
R7731:Ankrd11 UTSW 8 122895433 missense probably benign 0.12
R7792:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
RF019:Ankrd11 UTSW 8 122896634 missense probably damaging 1.00
Z1176:Ankrd11 UTSW 8 122895803 missense possibly damaging 0.68
Z1177:Ankrd11 UTSW 8 122900142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCACTGAATGGCACTG -3'
(R):5'- TACTTGTAGGGTTCACGTGCAG -3'

Sequencing Primer
(F):5'- GGCAATGAACCCGAAGAATCTCTTG -3'
(R):5'- AGGGTTCACGTGCAGCTCTG -3'
Posted On2020-01-23