Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Ncam1'

617460

Institutional Source

Beutler Lab

Gene Symbol

Ncam1

Ensembl Gene

ENSMUSG00000039542

Gene Name

neural cell adhesion molecule 1

Synonyms

NCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM

MMRRC Submission

067461-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49502136-49798925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 49564892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 299 (A299D)

Ref Sequence

ENSEMBL: ENSMUSP00000142275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114476
AA Change: A299D

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: A299D

Domain	Start	End	E-Value	Type
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
low complexity region	711	725	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: A299D

Domain	Start	End	E-Value	Type
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192584
AA Change: A299D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: A299D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	32	103	1.2e-6	SMART
IGc2	130	196	2.6e-8	SMART
IGc2	226	295	2.6e-22	SMART
IGc2	321	393	1.6e-16	SMART
IGc2	418	487	4e-13	SMART
FN3	501	586	2.4e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193547
AA Change: A299D

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: A299D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194252
AA Change: A256D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Igf2r	T	A	17: 12,718,795	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Kcnn3	T	G	3: 89,609,703	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510	I88N	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,752,447	T913P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zbtb11	A	G	16: 56,006,020	K804R	probably damaging	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Ncam1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Ncam1	APN	9	49523565	missense	probably damaging	1.00
IGL01384:Ncam1	APN	9	49509852	missense	possibly damaging	0.76
IGL01798:Ncam1	APN	9	49508607	missense	probably damaging	1.00
IGL02239:Ncam1	APN	9	49567402	missense	probably damaging	1.00
IGL02368:Ncam1	APN	9	49543083	nonsense	probably null
IGL02616:Ncam1	APN	9	49508688	missense	probably benign	0.23
PIT4431001:Ncam1	UTSW	9	49798693	missense	probably benign	0.04
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0502:Ncam1	UTSW	9	49569818	unclassified	probably benign
R0924:Ncam1	UTSW	9	49562176	intron	probably benign
R1398:Ncam1	UTSW	9	49517589	intron	probably benign
R1440:Ncam1	UTSW	9	49544800	missense	probably damaging	1.00
R1491:Ncam1	UTSW	9	49505549	missense	probably benign	0.15
R1676:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R1743:Ncam1	UTSW	9	49557145	missense	probably damaging	1.00
R1769:Ncam1	UTSW	9	49545256	unclassified	probably benign
R1951:Ncam1	UTSW	9	49545192	missense	probably benign	0.36
R2143:Ncam1	UTSW	9	49543019	missense	possibly damaging	0.87
R2167:Ncam1	UTSW	9	49568481	missense	probably benign	0.42
R2170:Ncam1	UTSW	9	49798681	missense	probably benign	0.06
R2290:Ncam1	UTSW	9	49523651	splice site	probably benign
R2321:Ncam1	UTSW	9	49544832	unclassified	probably benign
R3001:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R3002:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R4026:Ncam1	UTSW	9	49564995	missense	probably benign	0.00
R4279:Ncam1	UTSW	9	49506959	intron	probably benign
R4289:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R4873:Ncam1	UTSW	9	49507621	intron	probably benign
R4875:Ncam1	UTSW	9	49507621	intron	probably benign
R4883:Ncam1	UTSW	9	49541883	splice site	probably null
R4899:Ncam1	UTSW	9	49545251	critical splice acceptor site	probably null
R4923:Ncam1	UTSW	9	49505479	missense	probably benign
R5041:Ncam1	UTSW	9	49566785	missense	probably damaging	1.00
R5058:Ncam1	UTSW	9	49798695	missense	probably benign	0.16
R5386:Ncam1	UTSW	9	49564874	missense	probably damaging	1.00
R5388:Ncam1	UTSW	9	49544754	missense	probably benign
R5512:Ncam1	UTSW	9	49509699	splice site	probably null
R5598:Ncam1	UTSW	9	49545751	missense	probably damaging	1.00
R5895:Ncam1	UTSW	9	49507043	missense	probably benign
R5972:Ncam1	UTSW	9	49507529	missense	possibly damaging	0.93
R6059:Ncam1	UTSW	9	49544666	missense	probably damaging	1.00
R6226:Ncam1	UTSW	9	49565004	missense	probably benign	0.00
R6392:Ncam1	UTSW	9	49523575	missense	probably damaging	0.99
R6750:Ncam1	UTSW	9	49567339	missense	probably damaging	1.00
R6799:Ncam1	UTSW	9	49508611	missense	probably damaging	0.99
R7230:Ncam1	UTSW	9	49509823	missense	probably benign	0.00
R7335:Ncam1	UTSW	9	49506911	missense
R7561:Ncam1	UTSW	9	49564942	missense	probably damaging	1.00
R7645:Ncam1	UTSW	9	49565003	missense	probably benign	0.01
R8023:Ncam1	UTSW	9	49509757	missense	probably benign	0.00
R8045:Ncam1	UTSW	9	49507436	missense
R8234:Ncam1	UTSW	9	49545223	missense	probably damaging	0.99
R8308:Ncam1	UTSW	9	49568517	missense	probably damaging	0.99
R8370:Ncam1	UTSW	9	49557131	nonsense	probably null
R8500:Ncam1	UTSW	9	49520145	missense	probably damaging	1.00
R8542:Ncam1	UTSW	9	49508598	missense	probably damaging	1.00
R8944:Ncam1	UTSW	9	49520193	missense	probably damaging	1.00
R8977:Ncam1	UTSW	9	49507525	missense	probably damaging	1.00
R9028:Ncam1	UTSW	9	49507436	missense
R9034:Ncam1	UTSW	9	49569898	missense	probably benign	0.42
R9106:Ncam1	UTSW	9	49517556	missense	probably damaging	0.99
R9224:Ncam1	UTSW	9	49508695	missense	probably damaging	1.00
R9330:Ncam1	UTSW	9	49544797	missense	probably benign
X0062:Ncam1	UTSW	9	49545601	nonsense	probably null
X0064:Ncam1	UTSW	9	49566680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGGTGTCAGAGCAGGCAG -3'
(R):5'- TTCGCACAGTGGGAAATGATCAG -3'

Sequencing Primer
(F):5'- GCAGGCAGCTCATGGTTG -3'
(R):5'- CAGAATCATCACCCTTTGCG -3'

Posted On

2020-01-23