Incidental Mutation 'R8022:Usp4'
ID 617465
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Name ubiquitin specific peptidase 4 (proto-oncogene)
Synonyms Unp, F730026I20Rik
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108225052-108269744 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108255670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 576 (E576G)
Ref Sequence ENSEMBL: ENSMUSP00000035237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035237] [ENSMUST00000194224] [ENSMUST00000194959]
AlphaFold P35123
PDB Structure Crystal structure of the N-terminal domains of the ubiquitin specific peptidase 4 (USP4) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035237
AA Change: E576G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612
AA Change: E576G

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000194224
AA Change: E576G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141321
Gene: ENSMUSG00000032612
AA Change: E576G

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.3e-30 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 633 1.4e-50 PFAM
Pfam:UCH_1 302 520 2.3e-8 PFAM
low complexity region 657 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194959
AA Change: E529G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612
AA Change: E529G

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195608
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108,240,099 (GRCm39) critical splice donor site probably null
IGL01663:Usp4 APN 9 108,243,079 (GRCm39) missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108,262,131 (GRCm39) missense probably damaging 1.00
IGL02486:Usp4 APN 9 108,228,228 (GRCm39) missense probably damaging 1.00
kleinesrot UTSW 9 108,233,661 (GRCm39) missense possibly damaging 0.95
R0148:Usp4 UTSW 9 108,268,870 (GRCm39) splice site probably null
R0285:Usp4 UTSW 9 108,255,763 (GRCm39) missense probably benign 0.33
R0591:Usp4 UTSW 9 108,225,228 (GRCm39) splice site probably benign
R0594:Usp4 UTSW 9 108,248,080 (GRCm39) splice site probably null
R0616:Usp4 UTSW 9 108,244,003 (GRCm39) missense probably benign
R1329:Usp4 UTSW 9 108,249,765 (GRCm39) missense probably damaging 1.00
R1508:Usp4 UTSW 9 108,249,873 (GRCm39) missense probably benign 0.14
R1752:Usp4 UTSW 9 108,251,441 (GRCm39) missense probably damaging 1.00
R1824:Usp4 UTSW 9 108,225,207 (GRCm39) missense probably damaging 1.00
R1846:Usp4 UTSW 9 108,249,935 (GRCm39) missense probably benign
R2196:Usp4 UTSW 9 108,250,885 (GRCm39) missense probably benign 0.07
R2925:Usp4 UTSW 9 108,245,055 (GRCm39) missense probably damaging 1.00
R4126:Usp4 UTSW 9 108,237,316 (GRCm39) missense probably benign 0.10
R4345:Usp4 UTSW 9 108,245,222 (GRCm39) intron probably benign
R4965:Usp4 UTSW 9 108,239,819 (GRCm39) missense probably damaging 1.00
R4981:Usp4 UTSW 9 108,258,617 (GRCm39) missense probably benign 0.00
R5110:Usp4 UTSW 9 108,239,877 (GRCm39) missense probably damaging 1.00
R5580:Usp4 UTSW 9 108,243,058 (GRCm39) missense probably benign 0.09
R5586:Usp4 UTSW 9 108,233,661 (GRCm39) missense possibly damaging 0.95
R5927:Usp4 UTSW 9 108,268,959 (GRCm39) missense probably benign 0.09
R6025:Usp4 UTSW 9 108,237,322 (GRCm39) missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108,233,703 (GRCm39) missense probably damaging 1.00
R6197:Usp4 UTSW 9 108,248,154 (GRCm39) missense probably damaging 1.00
R6742:Usp4 UTSW 9 108,251,438 (GRCm39) missense possibly damaging 0.74
R7320:Usp4 UTSW 9 108,265,505 (GRCm39) missense probably benign 0.00
R7458:Usp4 UTSW 9 108,245,055 (GRCm39) missense probably damaging 1.00
R7531:Usp4 UTSW 9 108,249,879 (GRCm39) missense probably damaging 1.00
R7563:Usp4 UTSW 9 108,256,543 (GRCm39) missense probably benign
R8510:Usp4 UTSW 9 108,265,581 (GRCm39) critical splice donor site probably null
R8996:Usp4 UTSW 9 108,268,909 (GRCm39) missense probably damaging 1.00
R9151:Usp4 UTSW 9 108,244,011 (GRCm39) missense probably benign 0.00
R9775:Usp4 UTSW 9 108,239,780 (GRCm39) missense probably damaging 1.00
X0026:Usp4 UTSW 9 108,225,069 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAACCTGTAATCACCTTGGAAATGG -3'
(R):5'- GTGCAAAACCCATTCATCTCAG -3'

Sequencing Primer
(F):5'- AATCACCTTGGAAATGGCTTATCTCC -3'
(R):5'- ACCATGCGATTACATTTCCAGTAC -3'
Posted On 2020-01-23