Incidental Mutation 'R8022:Zfp616'
ID617474
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Namezinc finger protein 616
SynonymsGm12330
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8022 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74069955-74087292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74084068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 479 (R479G)
Ref Sequence ENSEMBL: ENSMUSP00000104103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
AA Change: R479G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476
AA Change: R479G

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178159
AA Change: R388G
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: R388G

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crim1 T A 17: 78,315,555 I394N possibly damaging Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 unclassified probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 unclassified probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2265:Zfp616 UTSW 11 74085463 missense possibly damaging 0.89
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4043:Zfp616 UTSW 11 74085282 missense possibly damaging 0.50
R4273:Zfp616 UTSW 11 74083700 missense probably benign 0.00
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5198:Zfp616 UTSW 11 74083510 missense probably benign 0.33
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6494:Zfp616 UTSW 11 74085192 missense probably damaging 1.00
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
R7877:Zfp616 UTSW 11 74084362 missense probably damaging 1.00
R7889:Zfp616 UTSW 11 74085445 missense probably damaging 1.00
R7960:Zfp616 UTSW 11 74084362 missense probably damaging 1.00
R7972:Zfp616 UTSW 11 74085445 missense probably damaging 1.00
R8061:Zfp616 UTSW 11 74083514 missense possibly damaging 0.96
Z1176:Zfp616 UTSW 11 74083033 missense probably benign
Z1176:Zfp616 UTSW 11 74083219 missense possibly damaging 0.72
Z1176:Zfp616 UTSW 11 74085641 missense possibly damaging 0.90
Z1177:Zfp616 UTSW 11 74085052 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGATCATACCACATGGAGCC -3'
(R):5'- TTACAGTACAGATCCTGTGAGGG -3'

Sequencing Primer
(F):5'- GCCTTTATAAAAATGACTGGCAGG -3'
(R):5'- ACAGTACAGATCCTGTGAGGGTTTTG -3'
Posted On2020-01-23