Incidental Mutation 'R8022:Trav8d-1'
ID 617482
Institutional Source Beutler Lab
Gene Symbol Trav8d-1
Ensembl Gene ENSMUSG00000076770
Gene Name T cell receptor alpha variable 8D-1
Synonyms
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 53015967-53016452 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 53016284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 57 (Q57*)
Ref Sequence ENSEMBL: ENSMUSP00000100357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103580]
AlphaFold Q5R1H8
Predicted Effect probably null
Transcript: ENSMUST00000103580
AA Change: Q57*
SMART Domains Protein: ENSMUSP00000100357
Gene: ENSMUSG00000076770
AA Change: Q57*

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGv 38 111 5.79e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Uvssa T A 5: 33,566,848 (GRCm39) L515Q probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Trav8d-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Trav8d-1 APN 14 53,016,257 (GRCm39) missense probably benign 0.13
R7197:Trav8d-1 UTSW 14 53,016,435 (GRCm39) missense probably damaging 1.00
R7582:Trav8d-1 UTSW 14 53,016,326 (GRCm39) missense possibly damaging 0.77
R7714:Trav8d-1 UTSW 14 53,016,380 (GRCm39) missense probably benign 0.03
R7723:Trav8d-1 UTSW 14 53,016,321 (GRCm39) missense probably damaging 1.00
R8119:Trav8d-1 UTSW 14 53,016,425 (GRCm39) missense probably benign 0.05
RF009:Trav8d-1 UTSW 14 53,016,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTGACAAGTGAGTTTGGG -3'
(R):5'- TGTGCATCAGTAGCACAGAAG -3'

Sequencing Primer
(F):5'- CAACTGACAAGTGAGTTTGGGTTTAC -3'
(R):5'- GTGCATCAGTAGCACAGAAGTACAC -3'
Posted On 2020-01-23