Incidental Mutation 'R0680:Zswim9'
ID61749
Institutional Source Beutler Lab
Gene Symbol Zswim9
Ensembl Gene ENSMUSG00000070814
Gene Namezinc finger SWIM-type containing 9
Synonyms6330408A02Rik
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0680 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13258967-13278721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13260321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 636 (V636G)
Ref Sequence ENSEMBL: ENSMUSP00000104172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558]
Predicted Effect probably benign
Transcript: ENSMUST00000108532
AA Change: V636G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: V636G

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119139
SMART Domains Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119558
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik T A 10: 3,125,133 noncoding transcript Het
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Dennd2a A T 6: 39,483,062 L703Q probably damaging Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Gen1 T A 12: 11,241,869 S640C probably benign Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Olfr810 T A 10: 129,790,818 Y257F probably damaging Het
Pcdhb18 G C 18: 37,490,294 A226P probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Other mutations in Zswim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Zswim9 APN 7 13260321 missense possibly damaging 0.53
IGL02063:Zswim9 APN 7 13260681 missense probably damaging 0.98
R0568:Zswim9 UTSW 7 13261026 missense probably damaging 0.99
R1438:Zswim9 UTSW 7 13277218 missense possibly damaging 0.86
R1600:Zswim9 UTSW 7 13269571 missense probably damaging 1.00
R1678:Zswim9 UTSW 7 13277411 missense probably benign 0.04
R1745:Zswim9 UTSW 7 13269556 missense probably damaging 1.00
R1938:Zswim9 UTSW 7 13260214 nonsense probably null
R2025:Zswim9 UTSW 7 13269366 missense probably damaging 0.98
R3149:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3150:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3176:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3177:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3276:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3277:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3950:Zswim9 UTSW 7 13261577 missense possibly damaging 0.95
R4554:Zswim9 UTSW 7 13277162 missense probably benign 0.33
R4866:Zswim9 UTSW 7 13261169 missense probably damaging 0.99
R4953:Zswim9 UTSW 7 13269558 missense probably damaging 1.00
R5330:Zswim9 UTSW 7 13259985 missense probably damaging 1.00
R5394:Zswim9 UTSW 7 13260983 missense probably damaging 1.00
R5408:Zswim9 UTSW 7 13260826 missense possibly damaging 0.66
R5654:Zswim9 UTSW 7 13261168 missense probably damaging 0.99
R5810:Zswim9 UTSW 7 13260735 missense probably damaging 0.98
R5859:Zswim9 UTSW 7 13261445 missense probably damaging 0.99
R6235:Zswim9 UTSW 7 13261603 missense probably damaging 1.00
R6239:Zswim9 UTSW 7 13261331 nonsense probably null
R6249:Zswim9 UTSW 7 13260977 missense probably damaging 0.98
R6394:Zswim9 UTSW 7 13260963 missense probably damaging 0.99
R7077:Zswim9 UTSW 7 13259752 missense probably damaging 1.00
R7133:Zswim9 UTSW 7 13259737 missense probably damaging 0.98
R7178:Zswim9 UTSW 7 13259997 missense possibly damaging 0.53
R7595:Zswim9 UTSW 7 13261072 missense probably benign 0.21
R8005:Zswim9 UTSW 7 13261138 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGCATGGTACACCATTCCCCATC -3'
(R):5'- CAAGAGTCTTGAAGGAAGGCCCTG -3'

Sequencing Primer
(F):5'- ATTCCCCATCCCTAGAAGCCTC -3'
(R):5'- CCTGGAGAGACGTACAGTTGC -3'
Posted On2013-07-30