Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Zbtb11'

617490

Institutional Source

Beutler Lab

Gene Symbol

Zbtb11

Ensembl Gene

ENSMUSG00000022601

Gene Name

zinc finger and BTB domain containing 11

Synonyms

ZNF-U69274, 9230110G02Rik

MMRRC Submission

067461-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55973883-56008913 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56006020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 804 (K804R)

Ref Sequence

ENSEMBL: ENSMUSP00000056923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050248] [ENSMUST00000119981]

AlphaFold

G5E8B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000050248
AA Change: K804R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: K804R

Domain	Start	End	E-Value	Type
low complexity region	136	158	N/A	INTRINSIC
low complexity region	161	177	N/A	INTRINSIC
BTB	214	312	4.77e-13	SMART
low complexity region	371	399	N/A	INTRINSIC
ZnF_C2H2	566	588	1.1e-2	SMART
ZnF_C2H2	594	616	2.09e-3	SMART
low complexity region	623	640	N/A	INTRINSIC
ZnF_C2H2	648	670	4.47e-3	SMART
ZnF_C2H2	676	698	8.22e-2	SMART
ZnF_C2H2	704	726	2.27e-4	SMART
ZnF_C2H2	732	754	1.28e-3	SMART
ZnF_C2H2	763	785	2.95e-3	SMART
ZnF_C2H2	791	813	7.67e-2	SMART
ZnF_C2H2	819	843	2.95e-3	SMART
ZnF_C2H2	855	877	1.67e-2	SMART
ZnF_C2H2	883	905	3.02e0	SMART
ZnF_C2H2	911	934	9.58e-3	SMART
low complexity region	979	994	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119981

SMART Domains

Protein: ENSMUSP00000112565
Gene: ENSMUSG00000071533

Domain	Start	End	E-Value	Type
Pfam:PCNP	1	100	6.3e-59	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Igf2r	T	A	17: 12,718,795	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Kcnn3	T	G	3: 89,609,703	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncam1	G	T	9: 49,564,892	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510	I88N	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,752,447	T913P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Zbtb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Zbtb11	APN	16	56000602	nonsense	probably null
IGL01107:Zbtb11	APN	16	56006007	missense	probably damaging	1.00
IGL01341:Zbtb11	APN	16	55990931	missense	possibly damaging	0.68
IGL01510:Zbtb11	APN	16	55990343	missense	probably damaging	0.99
IGL01611:Zbtb11	APN	16	55980610	missense	probably damaging	1.00
IGL01736:Zbtb11	APN	16	55998160	missense	probably damaging	1.00
IGL01834:Zbtb11	APN	16	55991008	missense	probably benign	0.35
IGL02427:Zbtb11	APN	16	55982350	missense	possibly damaging	0.95
IGL02441:Zbtb11	APN	16	55974189	missense	possibly damaging	0.94
IGL02455:Zbtb11	APN	16	56000675	missense	probably damaging	1.00
PIT4544001:Zbtb11	UTSW	16	55998193	nonsense	probably null
R0987:Zbtb11	UTSW	16	55990708	missense	probably benign	0.00
R1414:Zbtb11	UTSW	16	55990560	nonsense	probably null
R1437:Zbtb11	UTSW	16	55991620	critical splice donor site	probably null
R1570:Zbtb11	UTSW	16	55990815	missense	probably benign
R1658:Zbtb11	UTSW	16	55974225	missense	possibly damaging	0.71
R1735:Zbtb11	UTSW	16	55990682	missense	probably benign
R2048:Zbtb11	UTSW	16	55998009	missense	probably damaging	1.00
R2925:Zbtb11	UTSW	16	55974084	missense	probably benign	0.00
R4072:Zbtb11	UTSW	16	55998064	missense	possibly damaging	0.89
R4075:Zbtb11	UTSW	16	55998064	missense	possibly damaging	0.89
R4076:Zbtb11	UTSW	16	55998064	missense	possibly damaging	0.89
R5023:Zbtb11	UTSW	16	56006065	missense	probably damaging	1.00
R5755:Zbtb11	UTSW	16	56000713	missense	probably benign	0.02
R5757:Zbtb11	UTSW	16	56007029	missense	probably damaging	1.00
R6218:Zbtb11	UTSW	16	55998073	missense	probably benign	0.00
R6313:Zbtb11	UTSW	16	55990491	missense	probably benign	0.03
R6461:Zbtb11	UTSW	16	56006871	missense	probably damaging	0.99
R6666:Zbtb11	UTSW	16	56006252	missense	probably damaging	1.00
R6807:Zbtb11	UTSW	16	55990502	missense	probably benign	0.03
R7194:Zbtb11	UTSW	16	56007188	missense	probably damaging	1.00
R7424:Zbtb11	UTSW	16	55990487	missense	probably benign	0.01
R8436:Zbtb11	UTSW	16	56000659	nonsense	probably null
R8532:Zbtb11	UTSW	16	55990889	missense	probably benign	0.03
R8806:Zbtb11	UTSW	16	55982274	missense	probably damaging	1.00
R9033:Zbtb11	UTSW	16	55998129	missense	probably benign
R9673:Zbtb11	UTSW	16	56006973	missense	probably damaging	1.00
RF014:Zbtb11	UTSW	16	55980597	missense	probably damaging	0.97
Z1176:Zbtb11	UTSW	16	55991502	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGCCGTCTCAAGCATTTTG -3'
(R):5'- CCATGGGTGGCCTTCTTTAC -3'

Sequencing Primer
(F):5'- TCCTTGATGCAAGACTGAAAATTAG -3'
(R):5'- CATGGGTGGCCTTCTTTACATGTC -3'

Posted On

2020-01-23