Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Igf2r'

617491

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

067461-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12718795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 535 (D535V)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: D535V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: D535V

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Kcnn3	T	G	3: 89,609,703	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncam1	G	T	9: 49,564,892	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510	I88N	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Thbs4	T	G	13: 92,752,447	T913P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zbtb11	A	G	16: 56,006,020	K804R	probably damaging	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCCAGCTCTACTACAGAAATGATGG -3'
(R):5'- ATTTTCAGCATGGCAGGAGG -3'

Sequencing Primer
(F):5'- AATGATGGAAAATGTGGGTATGTCTC -3'
(R):5'- AGGTGGCCTCGATGTGATTG -3'

Posted On

2020-01-23