Incidental Mutation 'R8022:Crim1'
ID617495
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Namecysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8022 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78200248-78376592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78315555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 394 (I394N)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112498
AA Change: I394N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: I394N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,223,854 T1386S probably benign Het
AI661453 T G 17: 47,466,236 S296A unknown Het
Ambp G T 4: 63,144,197 N268K probably damaging Het
Ankrd11 T C 8: 122,887,593 K2503E probably damaging Het
Ap1g1 C A 8: 109,832,735 R221S possibly damaging Het
Ap5z1 T C 5: 142,470,149 probably null Het
Aspa A C 11: 73,322,206 N103K probably benign Het
BC049730 T A 7: 24,714,174 I205N possibly damaging Het
Bend7 G A 2: 4,752,779 V211I probably benign Het
Bsn A G 9: 108,114,404 M1383T probably benign Het
Cad G T 5: 31,068,806 V1117F probably damaging Het
Cdh2 A G 18: 16,590,301 L856S probably damaging Het
Cdh7 T A 1: 110,061,108 S247T probably benign Het
Ces1b A G 8: 93,069,315 probably null Het
Chd7 T A 4: 8,751,605 V34E unknown Het
Clca3a2 A T 3: 144,805,766 F623I probably damaging Het
Cope T G 8: 70,312,803 M217R probably benign Het
Crnkl1 A T 2: 145,918,566 I644N probably damaging Het
Cry1 G A 10: 85,146,402 A360V probably damaging Het
Ctcfl A T 2: 173,118,766 V8D probably benign Het
Cyp2d34 G A 15: 82,616,114 Q475* probably null Het
Cyp39a1 T C 17: 43,746,577 Y436H probably damaging Het
Cyp3a25 T A 5: 145,977,668 Q484L probably benign Het
Dnah1 A G 14: 31,265,014 F3607S probably damaging Het
Dnali1 T A 4: 125,065,530 K23N possibly damaging Het
Ecel1 T C 1: 87,153,330 I313V probably benign Het
Ehhadh C A 16: 21,777,820 A53S probably benign Het
Epcam T C 17: 87,646,308 S277P probably benign Het
Fbxo10 T C 4: 45,062,062 I155V possibly damaging Het
Fgd6 A T 10: 94,044,344 K353N possibly damaging Het
Glce A T 9: 62,060,591 M426K probably benign Het
Glmp A T 3: 88,326,520 N228I probably damaging Het
Gm4787 C A 12: 81,377,720 V555F possibly damaging Het
Gm5114 T A 7: 39,409,376 H273L probably benign Het
Gzmg T A 14: 56,157,446 T122S probably benign Het
Hace1 T C 10: 45,700,970 V820A probably damaging Het
Igf2r T A 17: 12,718,795 D535V probably damaging Het
Kcnd3 A G 3: 105,458,873 M20V probably benign Het
Kcnn3 T G 3: 89,609,703 I473S possibly damaging Het
Klhl35 T A 7: 99,473,239 F94Y unknown Het
Kmt2c C T 5: 25,281,680 V4712I possibly damaging Het
Lepr A G 4: 101,782,557 E740G probably benign Het
Lmod3 T C 6: 97,248,299 D187G probably benign Het
Lsm3 C T 6: 91,519,561 H49Y probably benign Het
Magi1 T C 6: 93,697,365 S962G probably damaging Het
Man2b1 G A 8: 85,095,613 R782Q probably damaging Het
Mical2 A T 7: 112,303,767 K148N probably damaging Het
Nbeal1 C T 1: 60,260,272 Q1256* probably null Het
Ncam1 G T 9: 49,564,892 A299D possibly damaging Het
Ncapg A G 5: 45,681,794 D512G probably damaging Het
Nkiras2 A G 11: 100,624,287 N28D probably benign Het
Nprl2 A C 9: 107,543,061 K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 I88N probably damaging Het
Oas3 A G 5: 120,756,966 I986T possibly damaging Het
Olfr809 A T 10: 129,776,785 L305F possibly damaging Het
Pcsk1 A T 13: 75,099,293 Y187F possibly damaging Het
Pgc A G 17: 47,728,776 T32A probably benign Het
Ranbp2 A C 10: 58,485,861 D2660A possibly damaging Het
Retreg1 A G 15: 25,843,479 R46G Het
Rrbp1 C A 2: 143,956,792 K1100N probably benign Het
Rsph10b A T 5: 143,967,232 T676S probably benign Het
Setdb1 A T 3: 95,338,599 F672I probably damaging Het
Setdb1 T A 3: 95,347,085 D195V probably damaging Het
Slc12a8 A G 16: 33,625,086 E450G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc25a12 A T 2: 71,275,189 V667E unknown Het
Slc39a3 T C 10: 81,031,277 T212A probably benign Het
Slc45a1 C T 4: 150,638,309 G373S possibly damaging Het
Snx11 G A 11: 96,772,854 T53M probably damaging Het
Snx33 A G 9: 56,925,340 F482L possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stk32a C T 18: 43,315,101 Q382* probably null Het
Sun3 C A 11: 9,023,376 S167I probably damaging Het
Sycp2 A G 2: 178,355,062 L1116P probably damaging Het
Thbs4 T G 13: 92,752,447 T913P probably damaging Het
Trav8d-1 C T 14: 52,778,827 Q57* probably null Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Unc119b A T 5: 115,127,043 I204N probably damaging Het
Usp4 A G 9: 108,378,471 E576G probably damaging Het
Uvssa T A 5: 33,409,504 L515Q probably damaging Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Xpo6 G A 7: 126,169,254 L94F probably benign Het
Zbtb11 A G 16: 56,006,020 K804R probably damaging Het
Zfp616 A G 11: 74,084,068 R479G probably benign Het
Zfp661 T C 2: 127,577,924 T99A probably benign Het
Zfp839 A T 12: 110,855,098 Q115H probably damaging Het
Zyg11a C T 4: 108,189,568 probably null Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTAGAAGTCCGTTATGACCGC -3'
(R):5'- AGTGCTTACCTTCACACACG -3'

Sequencing Primer
(F):5'- ACCGCTGCCTTTGGATG -3'
(R):5'- TTCACACACGGGGCAAC -3'
Posted On2020-01-23