Incidental Mutation 'R8023:Hibch'
ID617499
Institutional Source Beutler Lab
Gene Symbol Hibch
Ensembl Gene ENSMUSG00000041426
Gene Name3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms2610509I15Rik, HIBYL-COA-H
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location52844929-52920986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52860038 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 30 (M30T)
Ref Sequence ENSEMBL: ENSMUSP00000045606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044478] [ENSMUST00000159352]
Predicted Effect probably benign
Transcript: ENSMUST00000044478
AA Change: M30T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045606
Gene: ENSMUSG00000041426
AA Change: M30T

DomainStartEndE-ValueType
Pfam:ECH_1 43 282 6.6e-34 PFAM
Pfam:ECH_2 45 375 3.9e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159352
AA Change: M30T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124976
Gene: ENSMUSG00000041426
AA Change: M30T

DomainStartEndE-ValueType
Pfam:ECH 44 299 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Hibch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Hibch APN 1 52885190 splice site probably benign
IGL00722:Hibch APN 1 52901320 missense probably damaging 0.96
IGL03130:Hibch APN 1 52885151 missense possibly damaging 0.88
IGL03327:Hibch APN 1 52920380 unclassified probably benign
IGL03346:Hibch APN 1 52920380 unclassified probably benign
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0494:Hibch UTSW 1 52902896 missense possibly damaging 0.73
R1853:Hibch UTSW 1 52901335 critical splice donor site probably null
R4838:Hibch UTSW 1 52885178 missense possibly damaging 0.55
R5239:Hibch UTSW 1 52865608 missense probably damaging 1.00
R5531:Hibch UTSW 1 52845069 utr 5 prime probably benign
R5583:Hibch UTSW 1 52901247 missense probably damaging 1.00
R5809:Hibch UTSW 1 52853700 missense probably benign 0.16
R6246:Hibch UTSW 1 52904642 missense probably damaging 0.99
R6365:Hibch UTSW 1 52868937 synonymous probably null
R7202:Hibch UTSW 1 52853715 splice site probably null
RF010:Hibch UTSW 1 52913732 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTTGCTTGGAGACTCCTC -3'
(R):5'- ACGGGAAAGCATCATTGGTGC -3'

Sequencing Primer
(F):5'- CTCCATGTGTTTAATCTGAGAAGCC -3'
(R):5'- CCAGGAATGTTCTCCTACAATGG -3'
Posted On2020-01-23