Incidental Mutation 'R8023:Mpz'
ID617501
Institutional Source Beutler Lab
Gene Symbol Mpz
Ensembl Gene ENSMUSG00000056569
Gene Namemyelin protein zero
SynonymsMpp, P0
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171150711-171161130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171160033 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 246 (D246G)
Ref Sequence ENSEMBL: ENSMUSP00000066701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070758] [ENSMUST00000111334]
Predicted Effect probably damaging
Transcript: ENSMUST00000070758
AA Change: D246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066701
Gene: ENSMUSG00000056569
AA Change: D246G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 184 248 4.3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111334
AA Change: D246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106966
Gene: ENSMUSG00000056569
AA Change: D246G

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 179 248 4.8e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Mpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Mpz APN 1 171160002 missense possibly damaging 0.84
IGL03051:Mpz APN 1 171158811 missense probably damaging 1.00
Half-pint UTSW 1 171159635 critical splice donor site probably null
taz UTSW 1 171158810 missense probably damaging 1.00
R0279:Mpz UTSW 1 171159929 splice site probably benign
R0791:Mpz UTSW 1 171158774 missense possibly damaging 0.85
R1164:Mpz UTSW 1 171158439 missense possibly damaging 0.92
R1368:Mpz UTSW 1 171159964 missense probably damaging 1.00
R4043:Mpz UTSW 1 171159771 splice site probably benign
R4857:Mpz UTSW 1 171158810 missense probably damaging 1.00
R5682:Mpz UTSW 1 171158894 missense possibly damaging 0.62
R6709:Mpz UTSW 1 171150732 unclassified probably benign
R7089:Mpz UTSW 1 171159635 critical splice donor site probably null
R7748:Mpz UTSW 1 171159940 critical splice acceptor site probably null
R7888:Mpz UTSW 1 171159635 critical splice donor site probably null
R7971:Mpz UTSW 1 171159635 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCGAAGGACTCCTCGAAG -3'
(R):5'- CCATCATGTTCTTGAGGGCG -3'

Sequencing Primer
(F):5'- CAGGTTAGTAGGGCTTGGGAC -3'
(R):5'- CGTTCTTGAGGCTGGTTCTAC -3'
Posted On2020-01-23