Incidental Mutation 'R8023:Card9'
ID617503
Institutional Source Beutler Lab
Gene Symbol Card9
Ensembl Gene ENSMUSG00000026928
Gene Namecaspase recruitment domain family, member 9
SynonymsLOC332579
Accession Numbers

Ncbi RefSeq: NM_001037747; MGI:2685628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26352176-26360918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26357315 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 274 (D274G)
Ref Sequence ENSEMBL: ENSMUSP00000097876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000100303]
Predicted Effect probably benign
Transcript: ENSMUST00000028294
AA Change: D274G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: D274G

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100303
AA Change: D274G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: D274G

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Card9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Card9 APN 2 26356862 missense probably benign
IGL02397:Card9 APN 2 26352329 missense probably damaging 1.00
IGL02506:Card9 APN 2 26354415 splice site probably benign
IGL02536:Card9 APN 2 26358832 missense possibly damaging 0.93
IGL02809:Card9 APN 2 26356864 missense probably benign 0.01
IGL02962:Card9 APN 2 26358017 critical splice acceptor site probably null
R1441:Card9 UTSW 2 26359390 missense probably benign 0.01
R1585:Card9 UTSW 2 26354386 missense probably benign 0.01
R1755:Card9 UTSW 2 26359534 missense probably damaging 0.99
R1959:Card9 UTSW 2 26354873 critical splice acceptor site probably null
R2972:Card9 UTSW 2 26357210 missense probably damaging 1.00
R4007:Card9 UTSW 2 26353000 missense possibly damaging 0.95
R4283:Card9 UTSW 2 26357297 missense possibly damaging 0.77
R4789:Card9 UTSW 2 26357620 missense probably damaging 0.99
R5381:Card9 UTSW 2 26358883 missense probably damaging 1.00
R5933:Card9 UTSW 2 26352497 missense probably damaging 1.00
R6379:Card9 UTSW 2 26356777 missense probably damaging 1.00
R7008:Card9 UTSW 2 26357799 missense possibly damaging 0.96
R7124:Card9 UTSW 2 26356884 critical splice acceptor site probably null
R7131:Card9 UTSW 2 26358835 missense probably damaging 1.00
R7171:Card9 UTSW 2 26359484 missense possibly damaging 0.78
R7237:Card9 UTSW 2 26356775 missense probably benign 0.00
Z1176:Card9 UTSW 2 26357796 missense probably damaging 1.00
Z1177:Card9 UTSW 2 26357551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTGACAGTGAGCCAGGTC -3'
(R):5'- AAAAGGACTTGCTGCAGGCC -3'

Sequencing Primer
(F):5'- AGTGAGCCAGGTCCCAGAC -3'
(R):5'- CCCGGGTGCAGGAGCTG -3'
Posted On2020-01-23