Incidental Mutation 'R8023:Tiparp'
ID617506
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65531803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906] [ENSMUST00000130705]
Predicted Effect probably benign
Transcript: ENSMUST00000047906
AA Change: D180G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: D180G

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130705
SMART Domains Protein: ENSMUSP00000119951
Gene: ENSMUSG00000034640

DomainStartEndE-ValueType
Blast:ZnF_C3H1 56 82 3e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1316:Tiparp UTSW 3 65553351 missense probably damaging 1.00
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5693:Tiparp UTSW 3 65553492 missense possibly damaging 0.89
R5765:Tiparp UTSW 3 65531350 missense possibly damaging 0.69
R6061:Tiparp UTSW 3 65553243 missense probably damaging 0.98
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCGCATCCTTCTACAGATG -3'
(R):5'- CCCTGCCATAAATGCAAGTG -3'

Sequencing Primer
(F):5'- TTCTACAGATGCTCCAGAACAGGG -3'
(R):5'- CTGCCATAAATGCAAGTGCCTTG -3'
Posted On2020-01-23