Incidental Mutation 'R8023:Hist2h2ac'
ID617509
Institutional Source Beutler Lab
Gene Symbol Hist2h2ac
Ensembl Gene ENSMUSG00000068855
Gene Namehistone cluster 2, H2ac
SynonymsH2a-613b
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96220361-96220880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96220790 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000088288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073115] [ENSMUST00000090781] [ENSMUST00000090782] [ENSMUST00000177442]
Predicted Effect probably benign
Transcript: ENSMUST00000073115
SMART Domains Protein: ENSMUSP00000072858
Gene: ENSMUSG00000063689

DomainStartEndE-ValueType
H2A 3 123 8.91e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090781
SMART Domains Protein: ENSMUSP00000088287
Gene: ENSMUSG00000068854

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
H2B 28 124 1.14e-71 SMART
Predicted Effect unknown
Transcript: ENSMUST00000090782
AA Change: S19P
SMART Domains Protein: ENSMUSP00000088288
Gene: ENSMUSG00000068855
AA Change: S19P

DomainStartEndE-ValueType
H2A 3 123 1.1e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177442
SMART Domains Protein: ENSMUSP00000134765
Gene: ENSMUSG00000015943

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:BolA 40 113 7.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Hist2h2ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03229:Hist2h2ac APN 3 96220637 missense probably damaging 1.00
R5072:Hist2h2ac UTSW 3 96220783 unclassified probably benign
R7686:Hist2h2ac UTSW 3 96220570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCCAGCAGCTTGTTG -3'
(R):5'- ACTTCTCAGGGGCCAAATAACC -3'

Sequencing Primer
(F):5'- ATGGCCAGCTGCAGATG -3'
(R):5'- GGGGCCAAATAACCACCAATG -3'
Posted On2020-01-23