Incidental Mutation 'R8023:Fndc7'
ID617511
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Namefibronectin type III domain containing 7
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108853678-108890008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108867145 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 599 (C599Y)
Ref Sequence ENSEMBL: ENSMUSP00000099680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
Predicted Effect probably damaging
Transcript: ENSMUST00000053065
AA Change: C513Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326
AA Change: C513Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102620
AA Change: C599Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: C599Y

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180063
AA Change: C599Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: C599Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108883468 missense probably benign 0.17
IGL02823:Fndc7 APN 3 108869171 missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108862931 missense probably benign 0.04
IGL03196:Fndc7 APN 3 108883444 missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108867308 missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108876532 missense probably benign 0.12
R0240:Fndc7 UTSW 3 108858919 splice site probably benign
R0324:Fndc7 UTSW 3 108876699 splice site probably null
R0457:Fndc7 UTSW 3 108876545 missense probably benign 0.02
R0630:Fndc7 UTSW 3 108876615 missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108870588 missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108869330 missense probably benign 0.14
R1772:Fndc7 UTSW 3 108870534 missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108876687 missense probably benign 0.00
R1957:Fndc7 UTSW 3 108883509 missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108869148 missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108858902 missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4652:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4791:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R4933:Fndc7 UTSW 3 108876670 missense probably benign 0.01
R5004:Fndc7 UTSW 3 108883473 missense probably damaging 1.00
R5042:Fndc7 UTSW 3 108862786 missense probably damaging 1.00
R5054:Fndc7 UTSW 3 108881347 missense probably damaging 0.97
R5175:Fndc7 UTSW 3 108869166 missense probably benign 0.04
R5325:Fndc7 UTSW 3 108883449 missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108856408 missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108862892 missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108881391 missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108870575 missense probably damaging 0.99
R6737:Fndc7 UTSW 3 108872278 missense probably damaging 1.00
R6993:Fndc7 UTSW 3 108876591 missense probably benign 0.00
R6998:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R6999:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7000:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7001:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7181:Fndc7 UTSW 3 108881324 critical splice donor site probably null
R7324:Fndc7 UTSW 3 108872221 missense probably benign 0.06
R7425:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R7631:Fndc7 UTSW 3 108869252 missense probably damaging 1.00
R7702:Fndc7 UTSW 3 108862813 missense probably damaging 0.98
R7713:Fndc7 UTSW 3 108870663 missense possibly damaging 0.90
R7909:Fndc7 UTSW 3 108862916 missense probably benign 0.04
R7990:Fndc7 UTSW 3 108862916 missense probably benign 0.04
Z1088:Fndc7 UTSW 3 108883500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTAGCAATTTTAGTGGTTTGAA -3'
(R):5'- TTAGTGCCCTGCTGTCCAG -3'

Sequencing Primer
(F):5'- CATTTAATCCTAGCAGTCAGGAGGC -3'
(R):5'- TGTCCAGCTGGTCTGACAG -3'
Posted On2020-01-23