Incidental Mutation 'R8023:Ccnc'
ID617512
Institutional Source Beutler Lab
Gene Symbol Ccnc
Ensembl Gene ENSMUSG00000028252
Gene Namecyclin C
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location21727701-21759922 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 21747578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065928] [ENSMUST00000102997] [ENSMUST00000108240] [ENSMUST00000120679]
Predicted Effect probably null
Transcript: ENSMUST00000065928
SMART Domains Protein: ENSMUSP00000069076
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102997
SMART Domains Protein: ENSMUSP00000100062
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108240
SMART Domains Protein: ENSMUSP00000103875
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120679
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die prenatally and exhibit growth retardation and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Ccnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ccnc APN 4 21742642 nonsense probably null
IGL01536:Ccnc APN 4 21732505 missense probably benign 0.01
IGL03083:Ccnc APN 4 21742683 missense possibly damaging 0.83
R1220:Ccnc UTSW 4 21732491 missense probably damaging 1.00
R1237:Ccnc UTSW 4 21730457 missense probably benign
R1558:Ccnc UTSW 4 21742671 missense probably benign 0.31
R2012:Ccnc UTSW 4 21741955 missense possibly damaging 0.65
R4901:Ccnc UTSW 4 21727894 missense probably damaging 0.96
R6427:Ccnc UTSW 4 21747578 critical splice donor site probably null
R6509:Ccnc UTSW 4 21740642 missense probably benign 0.27
R7421:Ccnc UTSW 4 21743291 missense probably damaging 1.00
R7563:Ccnc UTSW 4 21732220 missense probably damaging 0.99
R7842:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R7925:Ccnc UTSW 4 21730480 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGCTGGTTACAGTGGTG -3'
(R):5'- AAGCAGTCTGGAAGTTAGTGTC -3'

Sequencing Primer
(F):5'- TACAGTGGTGTCGAGTTGAGAAG -3'
(R):5'- CAGTCTGGAAGTTAGTGTCCATATAC -3'
Posted On2020-01-23