Incidental Mutation 'R8023:Rps6ka1'
ID617519
Institutional Source Beutler Lab
Gene Symbol Rps6ka1
Ensembl Gene ENSMUSG00000003644
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRsk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133847290-133887797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133867195 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 168 (L168Q)
Ref Sequence ENSEMBL: ENSMUSP00000101514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003741] [ENSMUST00000105894] [ENSMUST00000137486] [ENSMUST00000157067] [ENSMUST00000168974] [ENSMUST00000174481]
Predicted Effect probably damaging
Transcript: ENSMUST00000003741
AA Change: L168Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003741
Gene: ENSMUSG00000003644
AA Change: L168Q

DomainStartEndE-ValueType
S_TKc 62 310 9.36e-88 SMART
S_TK_X 311 372 7.03e-23 SMART
S_TKc 407 664 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105894
AA Change: L168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101514
Gene: ENSMUSG00000003644
AA Change: L168Q

DomainStartEndE-ValueType
S_TKc 62 321 6.4e-104 SMART
S_TK_X 322 383 7.03e-23 SMART
S_TKc 418 675 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137486
AA Change: L174Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119328
Gene: ENSMUSG00000003644
AA Change: L174Q

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 32 38 N/A INTRINSIC
S_TKc 68 327 6.4e-104 SMART
S_TK_X 328 389 7.03e-23 SMART
S_TKc 424 681 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000157067
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121341
Gene: ENSMUSG00000003644
AA Change: L169Q

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 63 322 6.4e-104 SMART
S_TK_X 323 384 7.03e-23 SMART
S_TKc 419 676 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168974
AA Change: L152Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126774
Gene: ENSMUSG00000003644
AA Change: L152Q

DomainStartEndE-ValueType
S_TKc 46 305 6.4e-104 SMART
S_TK_X 306 367 7.03e-23 SMART
S_TKc 402 659 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174481
AA Change: L58Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134507
Gene: ENSMUSG00000003644
AA Change: L58Q

DomainStartEndE-ValueType
S_TKc 1 211 2.13e-68 SMART
S_TK_X 212 273 7.03e-23 SMART
S_TKc 308 565 1.05e-104 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 nonidentical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Rps6ka1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rps6ka1 APN 4 133860870 missense probably damaging 0.99
IGL01388:Rps6ka1 APN 4 133871964 missense probably damaging 0.96
IGL02314:Rps6ka1 APN 4 133850754 missense probably damaging 1.00
IGL02803:Rps6ka1 APN 4 133880954 missense probably benign 0.01
IGL02902:Rps6ka1 APN 4 133871981 missense possibly damaging 0.82
IGL02945:Rps6ka1 APN 4 133867199 missense probably damaging 1.00
R0240:Rps6ka1 UTSW 4 133848531 missense probably benign 0.00
R0240:Rps6ka1 UTSW 4 133848531 missense probably benign 0.00
R1512:Rps6ka1 UTSW 4 133851004 missense probably damaging 0.99
R1732:Rps6ka1 UTSW 4 133860070 missense probably damaging 1.00
R1883:Rps6ka1 UTSW 4 133864043 missense probably damaging 1.00
R2086:Rps6ka1 UTSW 4 133872969 start codon destroyed probably null
R2571:Rps6ka1 UTSW 4 133860612 splice site probably null
R4764:Rps6ka1 UTSW 4 133860557 missense probably damaging 1.00
R5209:Rps6ka1 UTSW 4 133865818 missense probably damaging 1.00
R5544:Rps6ka1 UTSW 4 133872015 missense probably benign 0.07
R5930:Rps6ka1 UTSW 4 133871571 missense probably damaging 0.99
R5990:Rps6ka1 UTSW 4 133866397 missense probably damaging 1.00
R6211:Rps6ka1 UTSW 4 133869306 missense probably damaging 0.96
R6254:Rps6ka1 UTSW 4 133867224 missense possibly damaging 0.87
R7070:Rps6ka1 UTSW 4 133861448 missense probably benign
R7134:Rps6ka1 UTSW 4 133872062 missense probably benign
X0020:Rps6ka1 UTSW 4 133867165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCAAAGAGAGATAAATTCCTG -3'
(R):5'- TGCTGTTTCCAAGCTGTAGC -3'

Sequencing Primer
(F):5'- ATAAATTCCTGGGAGCGCC -3'
(R):5'- CTGTAGCGCAGGGAGTGAC -3'
Posted On2020-01-23